Incidental Mutation 'R6475:Cdh18'
ID517403
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6475 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23226936 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 161 (D161G)
Ref Sequence ENSEMBL: ENSMUSP00000153905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163361] [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040427
Predicted Effect probably benign
Transcript: ENSMUST00000163361
AA Change: D161G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129170
Gene: ENSMUSG00000040420
AA Change: D161G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
Pfam:Cadherin 273 337 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164787
AA Change: D161G

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: D161G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165614
AA Change: D161G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: D161G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
AA Change: D107G

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420
AA Change: D107G

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000226693
AA Change: D161G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb5 T A 8: 54,550,575 V44E probably damaging Het
Bmpr2 T A 1: 59,868,344 D865E probably damaging Het
Ccr4 A G 9: 114,492,979 V6A probably benign Het
Cd209a A T 8: 3,747,031 D102E probably damaging Het
Cog4 T A 8: 110,880,894 I671N possibly damaging Het
Col14a1 T G 15: 55,445,822 probably benign Het
Cpne6 A G 14: 55,513,653 D173G probably damaging Het
Daglb G T 5: 143,481,651 V275L probably benign Het
Defb43 G T 14: 63,011,872 probably null Het
Dhx30 A G 9: 110,085,052 V1022A possibly damaging Het
Egfem1 A T 3: 29,657,163 K297M probably damaging Het
Egfr A G 11: 16,891,259 I717V probably benign Het
Eif2ak1 T G 5: 143,818,010 probably null Het
Epb42 T C 2: 121,027,133 Y307C possibly damaging Het
Erlec1 G A 11: 30,948,442 Q10* probably null Het
Fam185a A G 5: 21,425,283 D39G probably benign Het
Fbxl4 T A 4: 22,433,661 D599E probably damaging Het
Fgfr2 T A 7: 130,201,120 T268S probably benign Het
Gabra1 A T 11: 42,162,555 M84K probably benign Het
Gba A G 3: 89,205,928 D222G probably benign Het
Gm3409 T A 5: 146,537,786 H37Q possibly damaging Het
Gm4559 A G 7: 142,274,150 C72R unknown Het
Grik4 T C 9: 42,629,008 N292S probably benign Het
Haao A G 17: 83,831,684 S274P possibly damaging Het
Hsd17b4 T A 18: 50,172,262 probably null Het
Igdcc4 A T 9: 65,120,321 S222C probably damaging Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Itgb7 T A 15: 102,216,266 D772V probably benign Het
Kif14 T C 1: 136,527,411 L1607P probably damaging Het
Klf5 A G 14: 99,301,381 T77A probably benign Het
Klhl29 C T 12: 5,091,030 V605I probably damaging Het
Map4k1 T C 7: 28,987,022 V105A probably damaging Het
Mctp2 A T 7: 72,200,344 probably null Het
Med12l A G 3: 59,257,079 E1364G probably damaging Het
Mup9 A T 4: 60,419,806 D30E possibly damaging Het
Naip1 T C 13: 100,409,088 R1311G probably damaging Het
Olfr1306 G A 2: 111,912,859 Q24* probably null Het
Olfr56 C T 11: 49,134,933 T247I probably benign Het
Olfr706 A G 7: 106,886,397 V140A probably benign Het
Olfr945 T A 9: 39,258,082 M197L probably benign Het
Pkd1l3 A C 8: 109,623,212 T230P unknown Het
Pthlh G T 6: 147,257,190 H91N probably damaging Het
Rapgef5 T A 12: 117,718,207 V239D probably damaging Het
Rita1 G A 5: 120,611,570 T26I probably damaging Het
Robo3 T C 9: 37,423,290 T615A probably damaging Het
Rpp38 T C 2: 3,329,607 D86G probably benign Het
Sec31a T C 5: 100,385,270 T539A probably damaging Het
Senp2 G T 16: 22,023,800 V205L probably damaging Het
Sept10 T C 10: 59,192,311 N63D possibly damaging Het
Sez6 A G 11: 77,973,844 Het
Spesp1 C T 9: 62,272,433 V398I probably benign Het
Tmbim7 G A 5: 3,664,319 G19S probably benign Het
Tnni3k A T 3: 154,941,058 L431* probably null Het
Trdn T A 10: 33,464,555 probably null Het
Tubb2a A G 13: 34,075,459 V116A possibly damaging Het
Ush1c T C 7: 46,229,219 D124G probably damaging Het
Zfp768 A T 7: 127,344,655 F103L probably damaging Het
Zfp799 A G 17: 32,820,846 S149P probably damaging Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23445987 missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23474052 missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23226684 missense probably damaging 1.00
Z1189:Cdh18 UTSW 15 23474283 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAAGGGGCCGGGACTATATTTATC -3'
(R):5'- GGCTTTGGCTTGAGATATTACAAG -3'

Sequencing Primer
(F):5'- GCCGGGACTATATTTATCATTGATG -3'
(R):5'- CAAGTATTTCTACACAGCCAT -3'
Posted On2018-05-21