Incidental Mutation 'R6458:Ak1'
ID517413
Institutional Source Beutler Lab
Gene Symbol Ak1
Ensembl Gene ENSMUSG00000026817
Gene Nameadenylate kinase 1
SynonymsAk-1, B430205N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32621758-32635058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32630373 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 61 (M61K)
Ref Sequence ENSEMBL: ENSMUSP00000123534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068271] [ENSMUST00000113277] [ENSMUST00000113278] [ENSMUST00000156578] [ENSMUST00000195721]
Predicted Effect probably damaging
Transcript: ENSMUST00000068271
AA Change: M77K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068479
Gene: ENSMUSG00000026817
AA Change: M77K

DomainStartEndE-ValueType
Pfam:AAA_33 26 173 2.7e-10 PFAM
Pfam:AAA_17 26 194 5.4e-8 PFAM
Pfam:ADK 29 185 1.3e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113277
AA Change: M61K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108902
Gene: ENSMUSG00000026817
AA Change: M61K

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113278
AA Change: M61K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108903
Gene: ENSMUSG00000026817
AA Change: M61K

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135392
Predicted Effect probably damaging
Transcript: ENSMUST00000156578
AA Change: M61K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123534
Gene: ENSMUSG00000026817
AA Change: M61K

DomainStartEndE-ValueType
Pfam:AAA_17 10 86 1.5e-10 PFAM
Pfam:ADK 13 89 3.5e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195721
AA Change: M56K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142174
Gene: ENSMUSG00000026817
AA Change: M56K

DomainStartEndE-ValueType
Pfam:ADK 13 96 2e-32 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adenylate kinase enzyme involved in energy metabolism and homeostasis of cellular adenine nucleotide ratios in different intracellular compartments. This gene is highly expressed in skeletal muscle, brain and erythrocytes. Certain mutations in this gene resulting in a functionally inadequate enzyme are associated with a rare genetic disorder causing nonspherocytic hemolytic anemia. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased adenosine triphosphate (ATP) turnover and reduced efficiency of ATP utilization during muscle contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Ak1 APN 2 32633495 unclassified probably benign
R1472:Ak1 UTSW 2 32630301 missense probably damaging 1.00
R1476:Ak1 UTSW 2 32633466 missense probably benign
R1876:Ak1 UTSW 2 32630270 missense probably damaging 0.99
R2004:Ak1 UTSW 2 32629610 missense probably benign
R4067:Ak1 UTSW 2 32629581 missense probably benign 0.05
R4246:Ak1 UTSW 2 32633372 missense possibly damaging 0.54
R4873:Ak1 UTSW 2 32631177 missense probably benign 0.28
R4875:Ak1 UTSW 2 32631177 missense probably benign 0.28
R5076:Ak1 UTSW 2 32633448 missense probably damaging 1.00
R6187:Ak1 UTSW 2 32633477 missense probably damaging 0.99
R6818:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6917:Ak1 UTSW 2 32631152 missense possibly damaging 0.86
R6919:Ak1 UTSW 2 32631122 missense possibly damaging 0.62
R8238:Ak1 UTSW 2 32633669 missense probably damaging 1.00
Z1088:Ak1 UTSW 2 32630271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCATTGAGGACCGTGGTG -3'
(R):5'- AGTAACTGAAGGGGCCACTC -3'

Sequencing Primer
(F):5'- CCGTGGTGGTGTCTGCC -3'
(R):5'- TGGAGAATGGCTGACCC -3'
Posted On2018-05-21