Incidental Mutation 'R6458:Ppm1j'
ID517419
Institutional Source Beutler Lab
Gene Symbol Ppm1j
Ensembl Gene ENSMUSG00000002228
Gene Nameprotein phosphatase 1J
Synonyms2310008J22Rik, Ppp2cz, PP2Czeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6458 (G1)
Quality Score201.009
Status Validated
Chromosome3
Chromosomal Location104781056-104786018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104781244 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000002298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002298] [ENSMUST00000139783]
Predicted Effect probably benign
Transcript: ENSMUST00000002298
AA Change: V53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002298
Gene: ENSMUSG00000002228
AA Change: V53A

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
PP2Cc 93 497 1.44e-32 SMART
PP2C_SIG 119 499 1.51e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139783
SMART Domains Protein: ENSMUSP00000123514
Gene: ENSMUSG00000055865

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TAFA 42 130 4.2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197264
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the serine/threonine protein phosphatase. The mouse homolog of this gene apparently belongs to the protein phosphatase 2C family of genes. The exact function of this gene is not yet known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Ppm1j
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01860:Ppm1j APN 3 104784092 missense probably damaging 1.00
IGL03088:Ppm1j APN 3 104785409 nonsense probably null
R0350:Ppm1j UTSW 3 104783371 missense probably benign 0.01
R5042:Ppm1j UTSW 3 104782720 missense probably null 0.67
R5113:Ppm1j UTSW 3 104784674 missense possibly damaging 0.80
R5870:Ppm1j UTSW 3 104785495 missense possibly damaging 0.95
R6145:Ppm1j UTSW 3 104781379 missense probably damaging 0.99
R6221:Ppm1j UTSW 3 104785776 missense possibly damaging 0.95
R6695:Ppm1j UTSW 3 104785486 missense probably damaging 1.00
R7084:Ppm1j UTSW 3 104784960 missense probably damaging 0.99
R7323:Ppm1j UTSW 3 104784113 missense probably damaging 1.00
R7617:Ppm1j UTSW 3 104783743 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGGAGGCAGCATGCTAAAC -3'
(R):5'- AAGAAGGTCGTGGAATTTGCACC -3'

Sequencing Primer
(F):5'- CAGCATGCTAAACCGGGTG -3'
(R):5'- GTGGAATTTGCACCCCGTC -3'
Posted On2018-05-21