Incidental Mutation 'R6458:Rgma'
ID517434
Institutional Source Beutler Lab
Gene Symbol Rgma
Ensembl Gene ENSMUSG00000070509
Gene Namerepulsive guidance molecule family member A
SynonymsRGM domain family, member A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location73375509-73419899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73409694 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 88 (V88E)
Ref Sequence ENSEMBL: ENSMUSP00000112599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094312] [ENSMUST00000119206] [ENSMUST00000128471] [ENSMUST00000139780]
Predicted Effect probably damaging
Transcript: ENSMUST00000094312
AA Change: V198E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091870
Gene: ENSMUSG00000070509
AA Change: V198E

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:RGM_N 48 223 6.6e-74 PFAM
Pfam:RGM_C 227 410 1.5e-75 PFAM
low complexity region 422 430 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119206
AA Change: V88E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112599
Gene: ENSMUSG00000070509
AA Change: V88E

DomainStartEndE-ValueType
Pfam:RGM_N 1 113 3.8e-45 PFAM
Pfam:RGM_C 117 302 1.8e-76 PFAM
low complexity region 312 320 N/A INTRINSIC
low complexity region 329 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128471
SMART Domains Protein: ENSMUSP00000116552
Gene: ENSMUSG00000070509

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:RGM_N 32 101 7.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139780
AA Change: V182E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206096
Meta Mutation Damage Score 0.9186 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Inactivation of this locus results in impaired cephalic closure and subsequent exencephaly, both with incomplete penetrance. The retinal topography of the visual system is normal in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Rgma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rgma APN 7 73417491 missense probably damaging 1.00
IGL01089:Rgma APN 7 73409714 missense possibly damaging 0.79
IGL01336:Rgma APN 7 73409318 missense possibly damaging 0.61
IGL01339:Rgma APN 7 73417483 missense probably damaging 1.00
IGL01340:Rgma APN 7 73417330 missense probably damaging 1.00
IGL02034:Rgma APN 7 73417433 missense probably damaging 0.99
IGL03003:Rgma APN 7 73417440 missense probably damaging 0.97
IGL03050:Rgma UTSW 7 73417515 missense probably damaging 1.00
R0173:Rgma UTSW 7 73417554 missense probably damaging 1.00
R0630:Rgma UTSW 7 73417618 missense probably damaging 1.00
R0691:Rgma UTSW 7 73409412 missense probably damaging 0.99
R0696:Rgma UTSW 7 73409412 missense probably damaging 0.99
R0971:Rgma UTSW 7 73391498 critical splice donor site probably null
R1394:Rgma UTSW 7 73417794 missense probably benign 0.06
R1395:Rgma UTSW 7 73417794 missense probably benign 0.06
R1707:Rgma UTSW 7 73417959 missense unknown
R1731:Rgma UTSW 7 73409412 missense probably damaging 0.99
R1792:Rgma UTSW 7 73417837 missense probably damaging 0.97
R2068:Rgma UTSW 7 73409631 missense probably damaging 0.98
R2327:Rgma UTSW 7 73417826 missense probably damaging 1.00
R4707:Rgma UTSW 7 73417816 missense probably damaging 1.00
R5976:Rgma UTSW 7 73409468 missense probably damaging 0.97
R6702:Rgma UTSW 7 73417320 missense probably damaging 1.00
R7123:Rgma UTSW 7 73409391 missense probably damaging 1.00
R7767:Rgma UTSW 7 73418004 missense unknown
R8169:Rgma UTSW 7 73375882 missense probably benign 0.25
V7732:Rgma UTSW 7 73417320 missense probably damaging 1.00
Z1177:Rgma UTSW 7 73409675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGAGCCAGCACAACTGC -3'
(R):5'- GTTGGTTTATATCCCGACAAGGAATC -3'

Sequencing Primer
(F):5'- AACTGCTCCAAGGACGGC -3'
(R):5'- TTATATCCCGACAAGGAATCTCTAC -3'
Posted On2018-05-21