Incidental Mutation 'R6458:Tmc5'
ID517436
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Nametransmembrane channel-like gene family 5
Synonyms4932443L08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001105252.1, NM_028930.3

Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118597297-118675086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118645316 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 472 (N472K)
Ref Sequence ENSEMBL: ENSMUSP00000114137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
Predicted Effect probably damaging
Transcript: ENSMUST00000057320
AA Change: N262K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650
AA Change: N262K

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098088
AA Change: N472K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650
AA Change: N472K

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121715
AA Change: N472K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650
AA Change: N472K

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121744
AA Change: N472K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650
AA Change: N472K

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Meta Mutation Damage Score 0.7100 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118656787 missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118623824 unclassified probably benign
IGL01633:Tmc5 APN 7 118623586 missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118652510 missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118645324 missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118627233 missense probably benign 0.36
IGL02890:Tmc5 APN 7 118645430 splice site probably benign
F5426:Tmc5 UTSW 7 118623323 missense probably benign
PIT4802001:Tmc5 UTSW 7 118672226 missense probably benign
R0068:Tmc5 UTSW 7 118634237 missense probably benign 0.44
R0470:Tmc5 UTSW 7 118639931 missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118666576 missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118627210 missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118666870 missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118666593 missense probably benign 0.30
R1486:Tmc5 UTSW 7 118673432 missense probably benign 0.02
R1702:Tmc5 UTSW 7 118672239 missense probably benign 0.00
R2188:Tmc5 UTSW 7 118654955 missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118645395 missense probably benign 0.01
R3893:Tmc5 UTSW 7 118645369 missense probably damaging 1.00
R3927:Tmc5 UTSW 7 118652655 nonsense probably null
R4171:Tmc5 UTSW 7 118649587 missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118674663 makesense probably null
R4554:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4555:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4557:Tmc5 UTSW 7 118670733 missense probably benign 0.16
R4833:Tmc5 UTSW 7 118628829 missense probably benign 0.11
R4845:Tmc5 UTSW 7 118642381 missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118645339 missense probably benign 0.32
R5087:Tmc5 UTSW 7 118645386 missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118647932 missense probably damaging 1.00
R5723:Tmc5 UTSW 7 118672193 missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118666611 critical splice donor site probably null
R5882:Tmc5 UTSW 7 118654919 missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118670725 missense probably damaging 1.00
R6244:Tmc5 UTSW 7 118634214 missense possibly damaging 0.93
R6360:Tmc5 UTSW 7 118633966 start codon destroyed probably null 1.00
R6375:Tmc5 UTSW 7 118656814 missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118647844 missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118669304 missense probably damaging 1.00
R7202:Tmc5 UTSW 7 118639956 missense possibly damaging 0.49
R7227:Tmc5 UTSW 7 118670666 missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118623597 nonsense probably null
R7562:Tmc5 UTSW 7 118623326 missense probably benign 0.10
R7808:Tmc5 UTSW 7 118669217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATGCACATATTCACAAAC -3'
(R):5'- TGTGGACAAATCTTCTGACCCC -3'

Sequencing Primer
(F):5'- ACTTGAACACCTGCAGTTGG -3'
(R):5'- AAATCTTCTGACCCCCACTAATGTG -3'
Posted On2018-05-21