Incidental Mutation 'R6458:Bco1'
ID517439
Institutional Source Beutler Lab
Gene Symbol Bco1
Ensembl Gene ENSMUSG00000031845
Gene Namebeta-carotene oxygenase 1
SynonymsBcdo1, betaCMOOX, Bcmo1, Bcdo, beta-CD, Cmoi
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6458 (G1)
Quality Score221.009
Status Validated
Chromosome8
Chromosomal Location117095854-117133720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117127506 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 390 (D390G)
Ref Sequence ENSEMBL: ENSMUSP00000134815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034308] [ENSMUST00000167370] [ENSMUST00000176860]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034308
AA Change: D390G

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034308
Gene: ENSMUSG00000031845
AA Change: D390G

DomainStartEndE-ValueType
Pfam:RPE65 5 519 9e-114 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167370
AA Change: D390G

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132042
Gene: ENSMUSG00000031845
AA Change: D390G

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176860
AA Change: D390G

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134815
Gene: ENSMUSG00000031845
AA Change: D390G

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176943
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Vitamin A metabolism is important for vital processes such as vision, embryonic development, cell differentiation, and membrane and skin protection. The protein encoded by this gene is a key enzyme in beta-carotene metabolism to vitamin A. It catalyzes the oxidative cleavage of beta,beta-carotene into two retinal molecules. Two alternatively spliced variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null mutation display fatty livers, elevated serum free fatty acid levels, increased susceptibility to diet-induced obesity, and impaired conversion of beta-carotene to vitamin A. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Bco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Bco1 APN 8 117130637 missense probably damaging 1.00
IGL01934:Bco1 APN 8 117096045 missense possibly damaging 0.90
IGL02182:Bco1 APN 8 117133066 missense probably damaging 1.00
IGL02375:Bco1 APN 8 117113439 missense probably benign 0.13
IGL02705:Bco1 APN 8 117117503 missense possibly damaging 0.95
H8562:Bco1 UTSW 8 117105647 splice site probably benign
R0453:Bco1 UTSW 8 117108777 missense possibly damaging 0.55
R0652:Bco1 UTSW 8 117105696 missense probably damaging 1.00
R1619:Bco1 UTSW 8 117108715 missense probably damaging 1.00
R1772:Bco1 UTSW 8 117130608 missense probably benign 0.03
R1827:Bco1 UTSW 8 117105759 missense probably damaging 1.00
R1834:Bco1 UTSW 8 117117437 missense probably benign 0.01
R2261:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2262:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2273:Bco1 UTSW 8 117108783 critical splice donor site probably null
R2274:Bco1 UTSW 8 117108783 critical splice donor site probably null
R3037:Bco1 UTSW 8 117127539 missense probably benign 0.00
R3792:Bco1 UTSW 8 117130676 missense possibly damaging 0.95
R3926:Bco1 UTSW 8 117127472 missense probably benign
R4193:Bco1 UTSW 8 117113469 missense probably damaging 1.00
R4661:Bco1 UTSW 8 117129241 missense probably benign 0.00
R4968:Bco1 UTSW 8 117131094 missense probably benign 0.00
R5277:Bco1 UTSW 8 117117389 splice site probably null
R5523:Bco1 UTSW 8 117108693 missense possibly damaging 0.67
R6006:Bco1 UTSW 8 117113591 splice site probably null
R6174:Bco1 UTSW 8 117113534 missense probably damaging 0.97
R6815:Bco1 UTSW 8 117113522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTTCCTGTGGTTACC -3'
(R):5'- TCTATCCAAGGACCAGAAATGTTGG -3'

Sequencing Primer
(F):5'- CTTCCTGTGGTTACCGCGAG -3'
(R):5'- TGGAAGCTATTTTTAAAAGATCCCC -3'
Posted On2018-05-21