Mutagenetix > Incidental Mutations

Incidental Mutation 'R6458:Muc16'

517440

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R6458 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18641721 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 4425 (D4425E)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: D4425E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot8	A	G	2: 164,804,735	V28A	possibly damaging	Het
Ak1	T	A	2: 32,630,373	M61K	probably damaging	Het
Akap12	T	C	10: 4,355,148	S653P	probably damaging	Het
Anapc4	G	A	5: 52,864,553	R659H	possibly damaging	Het
Arel1	T	C	12: 84,940,385	N86D	possibly damaging	Het
BC005561	A	T	5: 104,522,303	I1564L	probably benign	Het
Bco1	A	G	8: 117,127,506	D390G	possibly damaging	Het
Ccr1l1	A	T	9: 123,978,166	D81E	probably damaging	Het
Chd1	A	T	17: 15,730,602	N185I	probably benign	Het
Clca4b	T	G	3: 144,911,327	N854T	possibly damaging	Het
Col4a4	T	C	1: 82,455,825	T1466A	unknown	Het
Cxcr4	T	C	1: 128,589,094	I277V	probably benign	Het
Dgkq	A	G	5: 108,654,376	V441A	possibly damaging	Het
Dnah10	G	T	5: 124,809,269	L3030F	probably damaging	Het
Epg5	T	A	18: 77,948,254	D55E	probably benign	Het
Ermap	A	T	4: 119,178,140	N550K	probably damaging	Het
Fnbp1l	A	T	3: 122,556,440	I374N	probably damaging	Het
Gadl1	T	A	9: 116,041,002	*479K	probably null	Het
Gm5591	T	A	7: 38,519,035	T805S	probably damaging	Het
H2-T3	A	T	17: 36,187,019	M334K	possibly damaging	Het
Ihh	C	T	1: 74,946,442	A295T	probably damaging	Het
Il18r1	T	A	1: 40,491,182	Y356*	probably null	Het
Lingo3	A	G	10: 80,835,316	V260A	probably damaging	Het
Lrp2	T	G	2: 69,505,156	M1408L	probably benign	Het
Mical1	C	A	10: 41,484,735	H657N	probably benign	Het
Mpp2	T	A	11: 102,080,769	M12L	probably benign	Het
Muc4	T	A	16: 32,759,320		probably null	Het
Myt1l	T	A	12: 29,895,299	F1021Y	unknown	Het
Nbas	T	C	12: 13,288,749	S197P	probably damaging	Het
Nckap1	T	C	2: 80,512,549		probably null	Het
Nek1	T	G	8: 61,100,012	V903G	probably benign	Het
Olfr1184	T	A	2: 88,487,218	I162N	possibly damaging	Het
Olfr299	A	G	7: 86,465,680	I90V	probably damaging	Het
Olfr377-ps1	T	G	11: 73,388,691	S112R	probably damaging	Het
Olfr889	T	C	9: 38,116,054	V91A	possibly damaging	Het
Ppm1j	T	C	3: 104,781,244	V53A	probably benign	Het
Ralgapb	T	A	2: 158,444,620	D328E	probably damaging	Het
Rgma	T	A	7: 73,409,694	V88E	probably damaging	Het
Slc30a6	A	G	17: 74,423,113	T333A	probably damaging	Het
Spr	T	C	6: 85,137,057		probably null	Het
Srek1	A	T	13: 103,743,568	V494E	probably benign	Het
Ston1	A	T	17: 88,635,303	T46S	probably benign	Het
Stox2	T	C	8: 47,192,044	K858E	possibly damaging	Het
Thoc1	G	A	18: 9,993,333	R564Q	probably benign	Het
Tmc5	T	A	7: 118,645,316	N472K	probably damaging	Het
Ttc41	A	G	10: 86,758,270	T856A	possibly damaging	Het
Ttn	A	T	2: 76,778,510	W17721R	probably damaging	Het
Vmn1r69	A	G	7: 10,580,438	I43T	probably benign	Het
Vmn2r56	T	A	7: 12,694,057	I761F	probably damaging	Het
Zfp109	T	C	7: 24,228,445	D521G	probably benign	Het
Zfp516	A	G	18: 82,987,350	H793R	probably benign	Het
Zfp800	A	T	6: 28,244,216	I250N	probably damaging	Het
Zpbp	T	A	11: 11,408,538	Y243F	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGAATGAGTGTCCCATGGTG -3'
(R):5'- CACTGGTCTCTAGCTCTGGTATAC -3'

Sequencing Primer
(F):5'- CATGGTGTCTTAGATTCTGCTTGACC -3'
(R):5'- GGTCTCTAGCTCTGGTATACAAAGTC -3'

Posted On

2018-05-21