Incidental Mutation 'R6458:Mical1'
ID517445
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 1
SynonymsNical
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location41476314-41487032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 41484735 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 657 (H657N)
Ref Sequence ENSEMBL: ENSMUSP00000097519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019965] [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000155411]
Predicted Effect probably benign
Transcript: ENSMUST00000019965
SMART Domains Protein: ENSMUSP00000019965
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 11 272 3.9e-24 PFAM
transmembrane domain 322 344 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019967
AA Change: H730N

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823
AA Change: H730N

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099934
AA Change: H657N

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823
AA Change: H657N

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119962
AA Change: H730N

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823
AA Change: H730N

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125730
Predicted Effect probably benign
Transcript: ENSMUST00000126436
AA Change: H730N

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823
AA Change: H730N

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138657
Predicted Effect probably benign
Transcript: ENSMUST00000155411
SMART Domains Protein: ENSMUSP00000115461
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
SCOP:d2dnja_ 9 81 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136681
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mpp2 T A 11: 102,080,769 M12L probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5139:Mical1 UTSW 10 41478415 splice site probably null
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5560:Mical1 UTSW 10 41478965 missense probably damaging 1.00
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6047:Mical1 UTSW 10 41481707 critical splice donor site probably null
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6879:Mical1 UTSW 10 41484519 missense probably damaging 0.99
R6966:Mical1 UTSW 10 41479754 missense probably damaging 0.98
R7049:Mical1 UTSW 10 41482250 missense possibly damaging 0.63
R7095:Mical1 UTSW 10 41479210 splice site probably null
R7156:Mical1 UTSW 10 41485257 critical splice donor site probably null
R7312:Mical1 UTSW 10 41479776 critical splice donor site probably null
R8021:Mical1 UTSW 10 41482724 missense probably damaging 0.97
R8056:Mical1 UTSW 10 41481172 missense probably damaging 1.00
R8427:Mical1 UTSW 10 41478595 missense probably damaging 1.00
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Z1177:Mical1 UTSW 10 41481705 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGATGCTACAGGGGACTTGG -3'
(R):5'- ACCTAGTAGACACTGTCAGGC -3'

Sequencing Primer
(F):5'- CTACAGGGGACTTGGGGCTTTC -3'
(R):5'- CAAGTGTCCTTCAGTGGAGGAC -3'
Posted On2018-05-21