Incidental Mutation 'R6458:Mpp2'
ID517450
Institutional Source Beutler Lab
Gene Symbol Mpp2
Ensembl Gene ENSMUSG00000017314
Gene Namemembrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)
SynonymsDlg2, Dlgh2, Pals4, D11Bwg0652e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6458 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location102057015-102088515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102080769 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 12 (M12L)
Ref Sequence ENSEMBL: ENSMUSP00000017458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017458] [ENSMUST00000100398]
Predicted Effect probably benign
Transcript: ENSMUST00000017458
AA Change: M12L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000017458
Gene: ENSMUSG00000017314
AA Change: M12L

DomainStartEndE-ValueType
L27 11 66 1.19e-11 SMART
L27 67 121 2.46e-13 SMART
PDZ 149 219 1.89e-10 SMART
SH3 228 292 9.77e-11 SMART
GuKc 349 540 6.55e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100398
AA Change: M29L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097967
Gene: ENSMUSG00000017314
AA Change: M29L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
L27 28 83 1.19e-11 SMART
L27 84 138 2.46e-13 SMART
PDZ 166 236 1.89e-10 SMART
SH3 245 309 9.77e-11 SMART
GuKc 366 557 6.55e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147126
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Palmitoylated membrane protein 2 is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. Palmitoylated membrane protein 2 contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A G 2: 164,804,735 V28A possibly damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Akap12 T C 10: 4,355,148 S653P probably damaging Het
Anapc4 G A 5: 52,864,553 R659H possibly damaging Het
Arel1 T C 12: 84,940,385 N86D possibly damaging Het
BC005561 A T 5: 104,522,303 I1564L probably benign Het
Bco1 A G 8: 117,127,506 D390G possibly damaging Het
Ccr1l1 A T 9: 123,978,166 D81E probably damaging Het
Chd1 A T 17: 15,730,602 N185I probably benign Het
Clca4b T G 3: 144,911,327 N854T possibly damaging Het
Col4a4 T C 1: 82,455,825 T1466A unknown Het
Cxcr4 T C 1: 128,589,094 I277V probably benign Het
Dgkq A G 5: 108,654,376 V441A possibly damaging Het
Dnah10 G T 5: 124,809,269 L3030F probably damaging Het
Epg5 T A 18: 77,948,254 D55E probably benign Het
Ermap A T 4: 119,178,140 N550K probably damaging Het
Fnbp1l A T 3: 122,556,440 I374N probably damaging Het
Gadl1 T A 9: 116,041,002 *479K probably null Het
Gm5591 T A 7: 38,519,035 T805S probably damaging Het
H2-T3 A T 17: 36,187,019 M334K possibly damaging Het
Ihh C T 1: 74,946,442 A295T probably damaging Het
Il18r1 T A 1: 40,491,182 Y356* probably null Het
Lingo3 A G 10: 80,835,316 V260A probably damaging Het
Lrp2 T G 2: 69,505,156 M1408L probably benign Het
Mical1 C A 10: 41,484,735 H657N probably benign Het
Muc16 A T 9: 18,641,721 D4425E probably benign Het
Muc4 T A 16: 32,759,320 probably null Het
Myt1l T A 12: 29,895,299 F1021Y unknown Het
Nbas T C 12: 13,288,749 S197P probably damaging Het
Nckap1 T C 2: 80,512,549 probably null Het
Nek1 T G 8: 61,100,012 V903G probably benign Het
Olfr1184 T A 2: 88,487,218 I162N possibly damaging Het
Olfr299 A G 7: 86,465,680 I90V probably damaging Het
Olfr377-ps1 T G 11: 73,388,691 S112R probably damaging Het
Olfr889 T C 9: 38,116,054 V91A possibly damaging Het
Ppm1j T C 3: 104,781,244 V53A probably benign Het
Ralgapb T A 2: 158,444,620 D328E probably damaging Het
Rgma T A 7: 73,409,694 V88E probably damaging Het
Slc30a6 A G 17: 74,423,113 T333A probably damaging Het
Spr T C 6: 85,137,057 probably null Het
Srek1 A T 13: 103,743,568 V494E probably benign Het
Ston1 A T 17: 88,635,303 T46S probably benign Het
Stox2 T C 8: 47,192,044 K858E possibly damaging Het
Thoc1 G A 18: 9,993,333 R564Q probably benign Het
Tmc5 T A 7: 118,645,316 N472K probably damaging Het
Ttc41 A G 10: 86,758,270 T856A possibly damaging Het
Ttn A T 2: 76,778,510 W17721R probably damaging Het
Vmn1r69 A G 7: 10,580,438 I43T probably benign Het
Vmn2r56 T A 7: 12,694,057 I761F probably damaging Het
Zfp109 T C 7: 24,228,445 D521G probably benign Het
Zfp516 A G 18: 82,987,350 H793R probably benign Het
Zfp800 A T 6: 28,244,216 I250N probably damaging Het
Zpbp T A 11: 11,408,538 Y243F probably damaging Het
Other mutations in Mpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Mpp2 APN 11 102063309 missense probably damaging 1.00
IGL01564:Mpp2 APN 11 102061519 missense probably benign 0.01
IGL02158:Mpp2 APN 11 102063262 missense probably benign 0.01
IGL02456:Mpp2 APN 11 102059373 missense possibly damaging 0.72
IGL03271:Mpp2 APN 11 102063423 splice site probably benign
R0488:Mpp2 UTSW 11 102061601 missense possibly damaging 0.64
R0512:Mpp2 UTSW 11 102062290 missense possibly damaging 0.64
R0960:Mpp2 UTSW 11 102061585 missense possibly damaging 0.80
R1572:Mpp2 UTSW 11 102060548 missense probably benign 0.07
R1740:Mpp2 UTSW 11 102062396 splice site probably null
R1867:Mpp2 UTSW 11 102064667 missense probably benign 0.09
R2133:Mpp2 UTSW 11 102064595 missense probably benign 0.01
R2277:Mpp2 UTSW 11 102064301 missense probably damaging 0.97
R2279:Mpp2 UTSW 11 102064301 missense probably damaging 0.97
R2313:Mpp2 UTSW 11 102062072 missense possibly damaging 0.77
R2882:Mpp2 UTSW 11 102064633 missense probably benign 0.00
R3429:Mpp2 UTSW 11 102085315 missense probably benign
R4719:Mpp2 UTSW 11 102064433 missense possibly damaging 0.93
R4959:Mpp2 UTSW 11 102063291 missense probably damaging 1.00
R4968:Mpp2 UTSW 11 102064298 missense probably benign 0.31
R5715:Mpp2 UTSW 11 102062261 missense probably damaging 1.00
R5778:Mpp2 UTSW 11 102064443 missense probably benign 0.06
R6034:Mpp2 UTSW 11 102061634 missense possibly damaging 0.88
R6034:Mpp2 UTSW 11 102061634 missense possibly damaging 0.88
R6045:Mpp2 UTSW 11 102059354 missense probably benign 0.05
R6275:Mpp2 UTSW 11 102060969 missense probably damaging 1.00
R6884:Mpp2 UTSW 11 102062078 missense probably benign 0.23
R6980:Mpp2 UTSW 11 102059328 missense probably damaging 1.00
R7699:Mpp2 UTSW 11 102059435 missense probably damaging 0.99
X0067:Mpp2 UTSW 11 102064385 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GTTCATCACCCAGGCACGATAC -3'
(R):5'- TGTCCCTAGGATCAATGCCC -3'

Sequencing Primer
(F):5'- ACCCTTCCAGGTGGCTTGTG -3'
(R):5'- CCCGAGGCATGCAAGGG -3'
Posted On2018-05-21