Incidental Mutation 'R6487:Rims4'
ID517469
Institutional Source Beutler Lab
Gene Symbol Rims4
Ensembl Gene ENSMUSG00000035226
Gene Nameregulating synaptic membrane exocytosis 4
SynonymsRim4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6487 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location163859751-163918683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 163864897 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 187 (F187Y)
Ref Sequence ENSEMBL: ENSMUSP00000045637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044734]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044734
AA Change: F187Y

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045637
Gene: ENSMUSG00000035226
AA Change: F187Y

DomainStartEndE-ValueType
C2 129 232 1.42e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induec allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,472 Y963H possibly damaging Het
Alpk2 T C 18: 65,266,183 N2108S possibly damaging Het
Atp13a1 T C 8: 69,799,878 S641P probably damaging Het
BC048403 T C 10: 121,745,541 L13P probably damaging Het
Bptf C T 11: 107,077,726 V981I probably damaging Het
Cntrl A T 2: 35,122,682 K277N possibly damaging Het
Cops5 T C 1: 10,037,779 T12A probably benign Het
Cyp2c37 A T 19: 39,994,581 T205S probably benign Het
Dnah7c T C 1: 46,769,124 V3485A probably damaging Het
Ifna6 A T 4: 88,827,506 N31Y probably damaging Het
Irgm1 C A 11: 48,865,950 A345S probably benign Het
Med13 T C 11: 86,331,150 T218A probably damaging Het
Mroh2b G T 15: 4,947,239 D1225Y probably damaging Het
Npepl1 A G 2: 174,111,732 E152G probably benign Het
Olfr1170 A G 2: 88,224,526 S169P possibly damaging Het
Olfr1260 A T 2: 89,977,838 D20V probably benign Het
Olfr1282 T C 2: 111,335,667 D137G probably benign Het
Olfr196 A T 16: 59,168,173 probably null Het
Olfr921 A G 9: 38,775,435 Y60C probably damaging Het
Oog2 A G 4: 144,196,485 E440G possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Shisa9 C T 16: 12,244,611 T232I probably benign Het
Slf1 A T 13: 77,066,617 I650N probably damaging Het
Tpst2 T C 5: 112,308,123 L176P probably damaging Het
U2surp A T 9: 95,477,512 M650K probably damaging Het
Vmn1r17 A T 6: 57,361,224 M3K possibly damaging Het
Vmn1r55 A G 7: 5,146,555 S290P probably benign Het
Vmn2r102 G A 17: 19,677,907 E395K probably damaging Het
Wapl T A 14: 34,692,292 H370Q probably damaging Het
Xab2 T C 8: 3,613,879 S347G possibly damaging Het
Other mutations in Rims4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Rims4 APN 2 163864102 missense probably damaging 1.00
IGL01980:Rims4 APN 2 163865782 splice site probably benign
demure UTSW 2 163864120 missense probably damaging 0.99
diminutive UTSW 2 163864865 critical splice donor site probably null
R0115:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0152:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0153:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0173:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0238:Rims4 UTSW 2 163864025 missense probably benign 0.03
R0481:Rims4 UTSW 2 163864120 missense probably damaging 0.99
R0702:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0735:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0973:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R0974:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1013:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1014:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1017:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1104:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1209:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1401:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R1554:Rims4 UTSW 2 163879122 missense probably damaging 1.00
R1618:Rims4 UTSW 2 163863929 missense possibly damaging 0.65
R2104:Rims4 UTSW 2 163864865 critical splice donor site probably null
R2171:Rims4 UTSW 2 163864126 splice site probably null
R3611:Rims4 UTSW 2 163879206 missense possibly damaging 0.50
R3735:Rims4 UTSW 2 163863985 missense possibly damaging 0.88
R3836:Rims4 UTSW 2 163918653 missense possibly damaging 0.86
R4685:Rims4 UTSW 2 163864994 nonsense probably null
R4849:Rims4 UTSW 2 163865543 missense probably benign 0.11
R4873:Rims4 UTSW 2 163865523 missense probably null 0.00
R4875:Rims4 UTSW 2 163865523 missense probably null 0.00
R5337:Rims4 UTSW 2 163865843 missense probably benign 0.00
R5415:Rims4 UTSW 2 163918676 missense probably benign 0.26
R5646:Rims4 UTSW 2 163864017 nonsense probably null
R7213:Rims4 UTSW 2 163864061 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCGACACAAGAAGTTGC -3'
(R):5'- CCTCATACCCACAATTTGAAGG -3'

Sequencing Primer
(F):5'- AGTGCTTCAAATCCCCTGGGTAAG -3'
(R):5'- TACCCACAATTTGAAGGAGCAG -3'
Posted On2018-05-21