Incidental Mutation 'R6487:Npepl1'
ID517470
Institutional Source Beutler Lab
Gene Symbol Npepl1
Ensembl Gene ENSMUSG00000039263
Gene Nameaminopeptidase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R6487 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location174110349-174123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174111732 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 152 (E152G)
Ref Sequence ENSEMBL: ENSMUSP00000042808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044415]
Predicted Effect probably benign
Transcript: ENSMUST00000044415
AA Change: E152G

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042808
Gene: ENSMUSG00000039263
AA Change: E152G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Pfam:Peptidase_M17 179 484 1.9e-98 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000125502
AA Change: E76G
SMART Domains Protein: ENSMUSP00000133202
Gene: ENSMUSG00000039263
AA Change: E76G

DomainStartEndE-ValueType
Pfam:Peptidase_M17 104 207 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,472 Y963H possibly damaging Het
Alpk2 T C 18: 65,266,183 N2108S possibly damaging Het
Atp13a1 T C 8: 69,799,878 S641P probably damaging Het
BC048403 T C 10: 121,745,541 L13P probably damaging Het
Bptf C T 11: 107,077,726 V981I probably damaging Het
Cntrl A T 2: 35,122,682 K277N possibly damaging Het
Cops5 T C 1: 10,037,779 T12A probably benign Het
Cyp2c37 A T 19: 39,994,581 T205S probably benign Het
Dnah7c T C 1: 46,769,124 V3485A probably damaging Het
Ifna6 A T 4: 88,827,506 N31Y probably damaging Het
Irgm1 C A 11: 48,865,950 A345S probably benign Het
Med13 T C 11: 86,331,150 T218A probably damaging Het
Mroh2b G T 15: 4,947,239 D1225Y probably damaging Het
Olfr1170 A G 2: 88,224,526 S169P possibly damaging Het
Olfr1260 A T 2: 89,977,838 D20V probably benign Het
Olfr1282 T C 2: 111,335,667 D137G probably benign Het
Olfr196 A T 16: 59,168,173 probably null Het
Olfr921 A G 9: 38,775,435 Y60C probably damaging Het
Oog2 A G 4: 144,196,485 E440G possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Rims4 A T 2: 163,864,897 F187Y possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Shisa9 C T 16: 12,244,611 T232I probably benign Het
Slf1 A T 13: 77,066,617 I650N probably damaging Het
Tpst2 T C 5: 112,308,123 L176P probably damaging Het
U2surp A T 9: 95,477,512 M650K probably damaging Het
Vmn1r17 A T 6: 57,361,224 M3K possibly damaging Het
Vmn1r55 A G 7: 5,146,555 S290P probably benign Het
Vmn2r102 G A 17: 19,677,907 E395K probably damaging Het
Wapl T A 14: 34,692,292 H370Q probably damaging Het
Xab2 T C 8: 3,613,879 S347G possibly damaging Het
Other mutations in Npepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Npepl1 APN 2 174120548 missense probably damaging 1.00
IGL01651:Npepl1 APN 2 174114388 splice site probably benign
IGL01998:Npepl1 APN 2 174116200 splice site probably benign
IGL02079:Npepl1 APN 2 174119390 intron probably benign
R0081:Npepl1 UTSW 2 174116086 missense probably damaging 1.00
R1236:Npepl1 UTSW 2 174114480 critical splice donor site probably null
R2350:Npepl1 UTSW 2 174111773 missense probably benign
R3780:Npepl1 UTSW 2 174120654 missense probably damaging 1.00
R3950:Npepl1 UTSW 2 174121113 missense probably damaging 1.00
R4688:Npepl1 UTSW 2 174114442 missense possibly damaging 0.78
R5650:Npepl1 UTSW 2 174121536 missense possibly damaging 0.83
R5916:Npepl1 UTSW 2 174121544 missense probably benign 0.01
R6007:Npepl1 UTSW 2 174121057 missense probably benign 0.03
R7267:Npepl1 UTSW 2 174122116 missense probably damaging 1.00
R7881:Npepl1 UTSW 2 174120594 missense probably damaging 1.00
R8103:Npepl1 UTSW 2 174111209 missense probably benign 0.00
Z1177:Npepl1 UTSW 2 174122130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGCTGCTATTGGGAGAGTC -3'
(R):5'- TGCATAATCAAATCACAGCTGC -3'

Sequencing Primer
(F):5'- AGAGTCCTGGTGGTGTCCC -3'
(R):5'- TGCACCAAACGGAGACCTG -3'
Posted On2018-05-21