Incidental Mutation 'R6487:Mroh2b'
ID517488
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6487 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4947239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1225 (D1225Y)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: D1225Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: D1225Y

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,472 Y963H possibly damaging Het
Alpk2 T C 18: 65,266,183 N2108S possibly damaging Het
Atp13a1 T C 8: 69,799,878 S641P probably damaging Het
BC048403 T C 10: 121,745,541 L13P probably damaging Het
Bptf C T 11: 107,077,726 V981I probably damaging Het
Cntrl A T 2: 35,122,682 K277N possibly damaging Het
Cops5 T C 1: 10,037,779 T12A probably benign Het
Cyp2c37 A T 19: 39,994,581 T205S probably benign Het
Dnah7c T C 1: 46,769,124 V3485A probably damaging Het
Ifna6 A T 4: 88,827,506 N31Y probably damaging Het
Irgm1 C A 11: 48,865,950 A345S probably benign Het
Med13 T C 11: 86,331,150 T218A probably damaging Het
Npepl1 A G 2: 174,111,732 E152G probably benign Het
Olfr1170 A G 2: 88,224,526 S169P possibly damaging Het
Olfr1260 A T 2: 89,977,838 D20V probably benign Het
Olfr1282 T C 2: 111,335,667 D137G probably benign Het
Olfr196 A T 16: 59,168,173 probably null Het
Olfr921 A G 9: 38,775,435 Y60C probably damaging Het
Oog2 A G 4: 144,196,485 E440G possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Rims4 A T 2: 163,864,897 F187Y possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Shisa9 C T 16: 12,244,611 T232I probably benign Het
Slf1 A T 13: 77,066,617 I650N probably damaging Het
Tpst2 T C 5: 112,308,123 L176P probably damaging Het
U2surp A T 9: 95,477,512 M650K probably damaging Het
Vmn1r17 A T 6: 57,361,224 M3K possibly damaging Het
Vmn1r55 A G 7: 5,146,555 S290P probably benign Het
Vmn2r102 G A 17: 19,677,907 E395K probably damaging Het
Wapl T A 14: 34,692,292 H370Q probably damaging Het
Xab2 T C 8: 3,613,879 S347G possibly damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 intron probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATCCACTAATCTACAAGTTGGGAGAG -3'
(R):5'- AAGGTTGGAGCCCACACTAC -3'

Sequencing Primer
(F):5'- TCTACAAGTTGGGAGAGGCTTAC -3'
(R):5'- TTGGAGCCCACACTACCACATTG -3'
Posted On2018-05-21