Incidental Mutation 'R6487:Cyp2c37'
ID517493
Institutional Source Beutler Lab
Gene Symbol Cyp2c37
Ensembl Gene ENSMUSG00000042248
Gene Namecytochrome P450, family 2. subfamily c, polypeptide 37
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6487 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location39992424-40012243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39994581 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 205 (T205S)
Ref Sequence ENSEMBL: ENSMUSP00000045362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049178]
Predicted Effect probably benign
Transcript: ENSMUST00000049178
AA Change: T205S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045362
Gene: ENSMUSG00000042248
AA Change: T205S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 5e-160 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,472 Y963H possibly damaging Het
Alpk2 T C 18: 65,266,183 N2108S possibly damaging Het
Atp13a1 T C 8: 69,799,878 S641P probably damaging Het
BC048403 T C 10: 121,745,541 L13P probably damaging Het
Bptf C T 11: 107,077,726 V981I probably damaging Het
Cntrl A T 2: 35,122,682 K277N possibly damaging Het
Cops5 T C 1: 10,037,779 T12A probably benign Het
Dnah7c T C 1: 46,769,124 V3485A probably damaging Het
Ifna6 A T 4: 88,827,506 N31Y probably damaging Het
Irgm1 C A 11: 48,865,950 A345S probably benign Het
Med13 T C 11: 86,331,150 T218A probably damaging Het
Mroh2b G T 15: 4,947,239 D1225Y probably damaging Het
Npepl1 A G 2: 174,111,732 E152G probably benign Het
Olfr1170 A G 2: 88,224,526 S169P possibly damaging Het
Olfr1260 A T 2: 89,977,838 D20V probably benign Het
Olfr1282 T C 2: 111,335,667 D137G probably benign Het
Olfr196 A T 16: 59,168,173 probably null Het
Olfr921 A G 9: 38,775,435 Y60C probably damaging Het
Oog2 A G 4: 144,196,485 E440G possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Rims4 A T 2: 163,864,897 F187Y possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Shisa9 C T 16: 12,244,611 T232I probably benign Het
Slf1 A T 13: 77,066,617 I650N probably damaging Het
Tpst2 T C 5: 112,308,123 L176P probably damaging Het
U2surp A T 9: 95,477,512 M650K probably damaging Het
Vmn1r17 A T 6: 57,361,224 M3K possibly damaging Het
Vmn1r55 A G 7: 5,146,555 S290P probably benign Het
Vmn2r102 G A 17: 19,677,907 E395K probably damaging Het
Wapl T A 14: 34,692,292 H370Q probably damaging Het
Xab2 T C 8: 3,613,879 S347G possibly damaging Het
Other mutations in Cyp2c37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Cyp2c37 APN 19 40001997 missense probably benign 0.00
IGL01307:Cyp2c37 APN 19 39992579 missense probably benign 0.00
IGL01959:Cyp2c37 APN 19 39995833 nonsense probably null
IGL02580:Cyp2c37 APN 19 39994498 missense probably damaging 1.00
IGL02611:Cyp2c37 APN 19 39993865 missense probably benign 0.00
R0124:Cyp2c37 UTSW 19 39994102 missense probably damaging 1.00
R0391:Cyp2c37 UTSW 19 39994506 missense probably damaging 1.00
R0420:Cyp2c37 UTSW 19 39995794 missense probably benign 0.00
R0782:Cyp2c37 UTSW 19 39993825 missense probably benign 0.00
R1413:Cyp2c37 UTSW 19 39994098 missense probably benign 0.21
R1637:Cyp2c37 UTSW 19 40001982 nonsense probably null
R1688:Cyp2c37 UTSW 19 39994443 splice site probably null
R2258:Cyp2c37 UTSW 19 39995859 missense possibly damaging 0.49
R4353:Cyp2c37 UTSW 19 40000545 missense possibly damaging 0.66
R4640:Cyp2c37 UTSW 19 40011832 missense possibly damaging 0.67
R4965:Cyp2c37 UTSW 19 40011762 missense possibly damaging 0.79
R5053:Cyp2c37 UTSW 19 40001887 missense probably benign 0.00
R5645:Cyp2c37 UTSW 19 39994152 missense probably benign 0.04
R5847:Cyp2c37 UTSW 19 40011732 missense probably damaging 0.98
R6631:Cyp2c37 UTSW 19 40009843 missense probably damaging 1.00
R7062:Cyp2c37 UTSW 19 39995546 intron probably null
Predicted Primers PCR Primer
(F):5'- AAGGGCAAGGTGTCTTCTATG -3'
(R):5'- GCCAAAGCTATCTTGGCATTG -3'

Sequencing Primer
(F):5'- GCTCCTTGCAATGTCATC -3'
(R):5'- GCAAGAGGTTTAGAACTTGCTTCC -3'
Posted On2018-05-21