Incidental Mutation 'R6459:Atp9a'
ID517501
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6459 (G1)
Quality Score115.008
Status Validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 168668013 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 500 (P500L)
Ref Sequence ENSEMBL: ENSMUSP00000136793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect probably damaging
Transcript: ENSMUST00000029060
AA Change: P500L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: P500L

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109175
AA Change: P484L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: P484L

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109176
AA Change: P558L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: P558L

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109177
AA Change: P482L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: P482L

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147757
Predicted Effect probably damaging
Transcript: ENSMUST00000178504
AA Change: P500L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: P500L

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr C A 11: 76,424,989 R583L probably damaging Het
Acss1 A G 2: 150,667,920 I93T probably damaging Het
Ank3 C T 10: 69,991,747 probably benign Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Atl3 A T 19: 7,520,798 E186D probably benign Het
Atp4a A G 7: 30,712,462 K41E probably benign Het
Ccdc88b A T 19: 6,854,878 V363D possibly damaging Het
Cftr T C 6: 18,258,236 V532A probably damaging Het
Cldn13 T C 5: 134,914,915 T139A possibly damaging Het
Cnksr3 T C 10: 7,126,820 Y124C probably benign Het
Cyb5r2 T C 7: 107,753,255 K161E possibly damaging Het
Epop T C 11: 97,628,507 S259G possibly damaging Het
Fhl2 G A 1: 43,123,653 T234I possibly damaging Het
Fnip2 T C 3: 79,481,634 T567A possibly damaging Het
Frmd4b A G 6: 97,487,640 C39R probably damaging Het
Grhl3 T C 4: 135,557,433 N116S possibly damaging Het
Igkv14-111 A T 6: 68,256,741 R75S probably benign Het
Il16 A T 7: 83,722,321 D92E probably damaging Het
Il16 C A 7: 83,722,328 G90V probably damaging Het
Ipo11 T C 13: 106,865,769 probably null Het
Kng2 A G 16: 23,012,115 I148T probably damaging Het
Lrrc41 T C 4: 116,088,780 S231P possibly damaging Het
Maneal C T 4: 124,856,842 V374I possibly damaging Het
Mgat4c T A 10: 102,385,127 L90Q probably damaging Het
Mrps28 A G 3: 8,899,980 probably null Het
Ncapd3 A G 9: 27,051,755 D452G probably benign Het
Nefh T C 11: 4,939,551 T1023A unknown Het
Nipa1 A G 7: 55,979,606 V253A probably benign Het
Olfr1028 G T 2: 85,951,518 G152C probably damaging Het
Olfr1447 G T 19: 12,901,005 F258L possibly damaging Het
Olfr199 C T 16: 59,216,020 V198M probably benign Het
Olfr228 T A 2: 86,483,229 H171L probably benign Het
Olfr930 A G 9: 38,930,665 S165G probably benign Het
Pak1 A G 7: 97,907,881 D495G probably benign Het
Pcm1 G A 8: 41,261,036 R213H probably damaging Het
Prg4 T C 1: 150,454,301 probably benign Het
Proser1 C T 3: 53,478,329 T544M possibly damaging Het
Rftn1 T C 17: 50,047,306 M343V probably benign Het
Ryr1 T C 7: 29,015,654 I4656V probably benign Het
Scg2 T A 1: 79,436,290 N239Y probably damaging Het
Sec16a C A 2: 26,423,500 M1949I probably benign Het
Sipa1l2 A G 8: 125,444,484 probably null Het
Slc10a2 A C 8: 5,098,581 probably null Het
Slc25a16 C T 10: 62,937,477 Q164* probably null Het
Specc1l T C 10: 75,246,167 Y483H probably damaging Het
Ston1 T C 17: 88,636,468 V434A probably benign Het
Tarbp2 A G 15: 102,518,479 probably benign Het
Trappc8 C T 18: 20,836,868 V1022M probably benign Het
Tsen54 T C 11: 115,821,680 V269A probably damaging Het
Vps13a A T 19: 16,664,018 M78K possibly damaging Het
Vwa5b2 A G 16: 20,594,679 T215A probably damaging Het
Zc3h7a A G 16: 11,153,161 Y335H probably damaging Het
Zfp994 T A 17: 22,200,546 Q474L possibly damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
R7490:Atp9a UTSW 2 168675352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTACCTTGAAGCCACTCC -3'
(R):5'- TCTCCATAGCAATCCCAGGATC -3'

Sequencing Primer
(F):5'- TGCTATATGAGACACTGTCCAC -3'
(R):5'- ATCCACCTGCTCAGAAGGG -3'
Posted On2018-05-21