Incidental Mutation 'R6459:Tsen54'
ID517530
Institutional Source Beutler Lab
Gene Symbol Tsen54
Ensembl Gene ENSMUSG00000020781
Gene NametRNA splicing endonuclease subunit 54
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6459 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115814724-115823094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115821680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 269 (V269A)
Ref Sequence ENSEMBL: ENSMUSP00000120506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021134] [ENSMUST00000103032] [ENSMUST00000106481] [ENSMUST00000133250] [ENSMUST00000136343] [ENSMUST00000154304] [ENSMUST00000177736]
Predicted Effect probably damaging
Transcript: ENSMUST00000021134
AA Change: V425A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021134
Gene: ENSMUSG00000020781
AA Change: V425A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 63 130 1.4e-21 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106481
AA Change: V425A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102090
Gene: ENSMUSG00000020781
AA Change: V425A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
Pfam:tRNA_int_end_N2 62 132 1.9e-23 PFAM
low complexity region 196 208 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 314 324 N/A INTRINSIC
coiled coil region 338 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128266
Predicted Effect probably benign
Transcript: ENSMUST00000133250
SMART Domains Protein: ENSMUSP00000118344
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
Blast:WD40 13 60 2e-20 BLAST
SCOP:d1gxra_ 19 118 5e-8 SMART
Blast:WD40 62 101 4e-22 BLAST
Blast:WD40 112 146 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000136343
AA Change: V269A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120506
Gene: ENSMUSG00000020781
AA Change: V269A

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
low complexity region 158 168 N/A INTRINSIC
coiled coil region 182 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141748
Predicted Effect probably damaging
Transcript: ENSMUST00000154304
AA Change: V108A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116955
Gene: ENSMUSG00000020781
AA Change: V108A

DomainStartEndE-ValueType
coiled coil region 21 43 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000157061
AA Change: V62A
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr C A 11: 76,424,989 R583L probably damaging Het
Acss1 A G 2: 150,667,920 I93T probably damaging Het
Ank3 C T 10: 69,991,747 probably benign Het
Aoah A G 13: 20,999,942 Y392C probably damaging Het
Atl3 A T 19: 7,520,798 E186D probably benign Het
Atp4a A G 7: 30,712,462 K41E probably benign Het
Atp9a G A 2: 168,668,013 P500L probably damaging Het
Ccdc88b A T 19: 6,854,878 V363D possibly damaging Het
Cftr T C 6: 18,258,236 V532A probably damaging Het
Cldn13 T C 5: 134,914,915 T139A possibly damaging Het
Cnksr3 T C 10: 7,126,820 Y124C probably benign Het
Cyb5r2 T C 7: 107,753,255 K161E possibly damaging Het
Epop T C 11: 97,628,507 S259G possibly damaging Het
Fhl2 G A 1: 43,123,653 T234I possibly damaging Het
Fnip2 T C 3: 79,481,634 T567A possibly damaging Het
Frmd4b A G 6: 97,487,640 C39R probably damaging Het
Grhl3 T C 4: 135,557,433 N116S possibly damaging Het
Igkv14-111 A T 6: 68,256,741 R75S probably benign Het
Il16 A T 7: 83,722,321 D92E probably damaging Het
Il16 C A 7: 83,722,328 G90V probably damaging Het
Ipo11 T C 13: 106,865,769 probably null Het
Kng2 A G 16: 23,012,115 I148T probably damaging Het
Lrrc41 T C 4: 116,088,780 S231P possibly damaging Het
Maneal C T 4: 124,856,842 V374I possibly damaging Het
Mgat4c T A 10: 102,385,127 L90Q probably damaging Het
Mrps28 A G 3: 8,899,980 probably null Het
Ncapd3 A G 9: 27,051,755 D452G probably benign Het
Nefh T C 11: 4,939,551 T1023A unknown Het
Nipa1 A G 7: 55,979,606 V253A probably benign Het
Olfr1028 G T 2: 85,951,518 G152C probably damaging Het
Olfr1447 G T 19: 12,901,005 F258L possibly damaging Het
Olfr199 C T 16: 59,216,020 V198M probably benign Het
Olfr228 T A 2: 86,483,229 H171L probably benign Het
Olfr930 A G 9: 38,930,665 S165G probably benign Het
Pak1 A G 7: 97,907,881 D495G probably benign Het
Pcm1 G A 8: 41,261,036 R213H probably damaging Het
Prg4 T C 1: 150,454,301 probably benign Het
Proser1 C T 3: 53,478,329 T544M possibly damaging Het
Rftn1 T C 17: 50,047,306 M343V probably benign Het
Ryr1 T C 7: 29,015,654 I4656V probably benign Het
Scg2 T A 1: 79,436,290 N239Y probably damaging Het
Sec16a C A 2: 26,423,500 M1949I probably benign Het
Sipa1l2 A G 8: 125,444,484 probably null Het
Slc10a2 A C 8: 5,098,581 probably null Het
Slc25a16 C T 10: 62,937,477 Q164* probably null Het
Specc1l T C 10: 75,246,167 Y483H probably damaging Het
Ston1 T C 17: 88,636,468 V434A probably benign Het
Tarbp2 A G 15: 102,518,479 probably benign Het
Trappc8 C T 18: 20,836,868 V1022M probably benign Het
Vps13a A T 19: 16,664,018 M78K possibly damaging Het
Vwa5b2 A G 16: 20,594,679 T215A probably damaging Het
Zc3h7a A G 16: 11,153,161 Y335H probably damaging Het
Zfp994 T A 17: 22,200,546 Q474L possibly damaging Het
Other mutations in Tsen54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Tsen54 APN 11 115821712 missense possibly damaging 0.90
PIT4486001:Tsen54 UTSW 11 115822596 missense probably damaging 1.00
R0179:Tsen54 UTSW 11 115822030 missense probably damaging 1.00
R0255:Tsen54 UTSW 11 115815408 missense probably damaging 1.00
R0380:Tsen54 UTSW 11 115822597 missense probably damaging 1.00
R0619:Tsen54 UTSW 11 115815064 missense probably damaging 1.00
R0653:Tsen54 UTSW 11 115815061 missense probably damaging 1.00
R1120:Tsen54 UTSW 11 115815013 missense probably damaging 0.98
R2109:Tsen54 UTSW 11 115815723 missense probably damaging 1.00
R2248:Tsen54 UTSW 11 115815406 missense probably damaging 1.00
R2300:Tsen54 UTSW 11 115822078 missense probably damaging 1.00
R3081:Tsen54 UTSW 11 115820164 missense probably benign 0.08
R3763:Tsen54 UTSW 11 115820411 missense probably benign 0.22
R4179:Tsen54 UTSW 11 115820852 missense probably damaging 0.99
R4521:Tsen54 UTSW 11 115817106 critical splice donor site probably null
R4618:Tsen54 UTSW 11 115815421 unclassified probably benign
R5485:Tsen54 UTSW 11 115815222 missense probably benign 0.15
R6111:Tsen54 UTSW 11 115820130 missense possibly damaging 0.82
R6238:Tsen54 UTSW 11 115820687 missense probably benign 0.02
R6555:Tsen54 UTSW 11 115820693 missense probably benign 0.43
R7378:Tsen54 UTSW 11 115821705 missense probably benign 0.19
R7520:Tsen54 UTSW 11 115820971 missense probably damaging 0.99
X0028:Tsen54 UTSW 11 115817099 missense possibly damaging 0.50
Z1176:Tsen54 UTSW 11 115820578 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACGCAGAACTCTGTAAGGC -3'
(R):5'- GCACTGGGAGCTAAGTATATAGGC -3'

Sequencing Primer
(F):5'- CTCTGTAAGGCATCATAGGAACATG -3'
(R):5'- CTAAGTATATAGGCAGGTGTCCC -3'
Posted On2018-05-21