Incidental Mutation 'R6459:Aoah'
ID517531
Institutional Source Beutler Lab
Gene Symbol Aoah
Ensembl Gene ENSMUSG00000021322
Gene Nameacyloxyacyl hydrolase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6459 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location20794113-21036617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20999942 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 392 (Y392C)
Ref Sequence ENSEMBL: ENSMUSP00000021757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021757]
Predicted Effect probably damaging
Transcript: ENSMUST00000021757
AA Change: Y392C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322
AA Change: Y392C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SapB 38 113 6.25e-15 SMART
Pfam:Lipase_GDSL 256 542 4.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr C A 11: 76,424,989 R583L probably damaging Het
Acss1 A G 2: 150,667,920 I93T probably damaging Het
Ank3 C T 10: 69,991,747 probably benign Het
Atl3 A T 19: 7,520,798 E186D probably benign Het
Atp4a A G 7: 30,712,462 K41E probably benign Het
Atp9a G A 2: 168,668,013 P500L probably damaging Het
Ccdc88b A T 19: 6,854,878 V363D possibly damaging Het
Cftr T C 6: 18,258,236 V532A probably damaging Het
Cldn13 T C 5: 134,914,915 T139A possibly damaging Het
Cnksr3 T C 10: 7,126,820 Y124C probably benign Het
Cyb5r2 T C 7: 107,753,255 K161E possibly damaging Het
Epop T C 11: 97,628,507 S259G possibly damaging Het
Fhl2 G A 1: 43,123,653 T234I possibly damaging Het
Fnip2 T C 3: 79,481,634 T567A possibly damaging Het
Frmd4b A G 6: 97,487,640 C39R probably damaging Het
Grhl3 T C 4: 135,557,433 N116S possibly damaging Het
Igkv14-111 A T 6: 68,256,741 R75S probably benign Het
Il16 A T 7: 83,722,321 D92E probably damaging Het
Il16 C A 7: 83,722,328 G90V probably damaging Het
Ipo11 T C 13: 106,865,769 probably null Het
Kng2 A G 16: 23,012,115 I148T probably damaging Het
Lrrc41 T C 4: 116,088,780 S231P possibly damaging Het
Maneal C T 4: 124,856,842 V374I possibly damaging Het
Mgat4c T A 10: 102,385,127 L90Q probably damaging Het
Mrps28 A G 3: 8,899,980 probably null Het
Ncapd3 A G 9: 27,051,755 D452G probably benign Het
Nefh T C 11: 4,939,551 T1023A unknown Het
Nipa1 A G 7: 55,979,606 V253A probably benign Het
Olfr1028 G T 2: 85,951,518 G152C probably damaging Het
Olfr1447 G T 19: 12,901,005 F258L possibly damaging Het
Olfr199 C T 16: 59,216,020 V198M probably benign Het
Olfr228 T A 2: 86,483,229 H171L probably benign Het
Olfr930 A G 9: 38,930,665 S165G probably benign Het
Pak1 A G 7: 97,907,881 D495G probably benign Het
Pcm1 G A 8: 41,261,036 R213H probably damaging Het
Prg4 T C 1: 150,454,301 probably benign Het
Proser1 C T 3: 53,478,329 T544M possibly damaging Het
Rftn1 T C 17: 50,047,306 M343V probably benign Het
Ryr1 T C 7: 29,015,654 I4656V probably benign Het
Scg2 T A 1: 79,436,290 N239Y probably damaging Het
Sec16a C A 2: 26,423,500 M1949I probably benign Het
Sipa1l2 A G 8: 125,444,484 probably null Het
Slc10a2 A C 8: 5,098,581 probably null Het
Slc25a16 C T 10: 62,937,477 Q164* probably null Het
Specc1l T C 10: 75,246,167 Y483H probably damaging Het
Ston1 T C 17: 88,636,468 V434A probably benign Het
Tarbp2 A G 15: 102,518,479 probably benign Het
Trappc8 C T 18: 20,836,868 V1022M probably benign Het
Tsen54 T C 11: 115,821,680 V269A probably damaging Het
Vps13a A T 19: 16,664,018 M78K possibly damaging Het
Vwa5b2 A G 16: 20,594,679 T215A probably damaging Het
Zc3h7a A G 16: 11,153,161 Y335H probably damaging Het
Zfp994 T A 17: 22,200,546 Q474L possibly damaging Het
Other mutations in Aoah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Aoah APN 13 21005094 missense probably damaging 0.97
IGL01561:Aoah APN 13 20905735 splice site probably benign
IGL01717:Aoah APN 13 20999977 missense probably damaging 0.99
IGL01997:Aoah APN 13 20999938 missense probably benign 0.00
IGL02212:Aoah APN 13 21002901 missense probably benign 0.05
IGL02325:Aoah APN 13 20917125 missense probably damaging 0.97
IGL03028:Aoah APN 13 20816582 missense possibly damaging 0.62
IGL03304:Aoah APN 13 20915010 splice site probably benign
IGL03352:Aoah APN 13 21000043 missense probably benign 0.01
H8562:Aoah UTSW 13 20816524 missense probably damaging 1.00
PIT4402001:Aoah UTSW 13 20794510 missense probably benign 0.00
R0255:Aoah UTSW 13 20979540 nonsense probably null
R0432:Aoah UTSW 13 20911198 splice site probably benign
R0501:Aoah UTSW 13 21005073 missense probably benign 0.16
R1036:Aoah UTSW 13 20840169 splice site probably benign
R1119:Aoah UTSW 13 20914938 splice site probably benign
R1203:Aoah UTSW 13 20816594 missense probably damaging 1.00
R1589:Aoah UTSW 13 21002948 missense probably damaging 0.99
R1662:Aoah UTSW 13 21000113 intron probably null
R1907:Aoah UTSW 13 20910094 missense probably damaging 1.00
R1959:Aoah UTSW 13 20794394 start codon destroyed probably null 0.89
R2145:Aoah UTSW 13 20840096 missense probably damaging 1.00
R2237:Aoah UTSW 13 20794311 start gained probably benign
R3438:Aoah UTSW 13 20917072 missense probably benign 0.00
R4226:Aoah UTSW 13 20979526 missense possibly damaging 0.50
R4868:Aoah UTSW 13 20914981 nonsense probably null
R5026:Aoah UTSW 13 20914959 missense probably damaging 1.00
R5139:Aoah UTSW 13 21023237 missense possibly damaging 0.61
R5624:Aoah UTSW 13 20995479 missense probably damaging 1.00
R5853:Aoah UTSW 13 20999902 missense probably benign 0.01
R6134:Aoah UTSW 13 20911123 missense probably damaging 1.00
R7077:Aoah UTSW 13 20910106 missense probably damaging 1.00
R7103:Aoah UTSW 13 21023315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCAGTTTGACTATGTGCCAG -3'
(R):5'- ATGCATTGCTCATACATCACAC -3'

Sequencing Primer
(F):5'- CAGTTTGACTATGTGCCAGAAAGG -3'
(R):5'- TATATCTGCACACTCATACAAATAGC -3'
Posted On2018-05-21