Incidental Mutation 'R6460:Sycp1'
ID 517551
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Name synaptonemal complex protein 1
Synonyms SCP1
MMRRC Submission 044595-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.495) question?
Stock # R6460 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 102725815-102843416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 102832569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 199 (Y199S)
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988] [ENSMUST00000199930]
AlphaFold Q62209
Predicted Effect probably damaging
Transcript: ENSMUST00000029448
AA Change: Y199S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: Y199S

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196988
AA Change: Y199S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: Y199S

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199930
AA Change: Y144S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143493
Gene: ENSMUSG00000027855
AA Change: Y144S

DomainStartEndE-ValueType
Pfam:SCP-1 28 95 2e-33 PFAM
Pfam:SCP-1 93 182 9.8e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 79,844,862 (GRCm39) H1528L probably benign Het
Ablim1 A G 19: 57,068,271 (GRCm39) S263P possibly damaging Het
Ahnak2 T C 12: 112,750,610 (GRCm39) E104G probably null Het
Apof T A 10: 128,105,086 (GRCm39) M80K probably damaging Het
Arfgef1 C T 1: 10,283,285 (GRCm39) R208H probably damaging Het
Arhgef33 A G 17: 80,657,018 (GRCm39) probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,093,420 (GRCm39) probably benign Het
Cabcoco1 T C 10: 68,352,211 (GRCm39) K34E probably damaging Het
Col4a4 C A 1: 82,444,253 (GRCm39) G1338V unknown Het
Coq9 T A 8: 95,579,814 (GRCm39) D256E probably damaging Het
Dnajc18 A T 18: 35,833,963 (GRCm39) C41S probably benign Het
Dnajc6 A G 4: 101,472,795 (GRCm39) I307M probably damaging Het
Emg1 A G 6: 124,688,870 (GRCm39) V46A probably damaging Het
Eya3 A G 4: 132,408,174 (GRCm39) S157G probably damaging Het
Eya4 T C 10: 23,027,910 (GRCm39) N274S probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fat3 A G 9: 15,878,296 (GRCm39) V3395A probably damaging Het
Fchsd1 A T 18: 38,092,897 (GRCm39) probably null Het
Gm4846 A G 1: 166,325,082 (GRCm39) V3A probably benign Het
Hecw2 T A 1: 53,907,992 (GRCm39) probably null Het
Herc3 T A 6: 58,867,108 (GRCm39) I10N probably damaging Het
Hhatl C T 9: 121,618,588 (GRCm39) R138H probably benign Het
Hspa9 A T 18: 35,085,765 (GRCm39) H35Q probably benign Het
Irgq T A 7: 24,233,115 (GRCm39) S319T probably benign Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Ksr2 T A 5: 117,894,449 (GRCm39) probably null Het
Lrriq1 T C 10: 103,036,559 (GRCm39) I865V probably damaging Het
Map2k1 A G 9: 64,094,577 (GRCm39) L355P probably damaging Het
Muc16 A G 9: 18,551,812 (GRCm39) I4827T probably benign Het
Myh1 T C 11: 67,112,202 (GRCm39) V1752A probably benign Het
Nfatc2ip A G 7: 125,986,909 (GRCm39) V282A probably damaging Het
Nrg1 T A 8: 32,308,561 (GRCm39) E485V probably damaging Het
Ofcc1 T C 13: 40,441,455 (GRCm39) D2G probably damaging Het
Or10d3 CAGAG CAG 9: 39,462,088 (GRCm39) probably null Het
Pclo T C 5: 14,729,146 (GRCm39) probably benign Het
Pom121 T C 5: 135,420,537 (GRCm39) K295E unknown Het
Rb1 A C 14: 73,515,894 (GRCm39) I294R probably benign Het
Schip1 C A 3: 68,402,227 (GRCm39) S101R probably benign Het
Sec24c T A 14: 20,740,868 (GRCm39) Y629N probably damaging Het
Shkbp1 T A 7: 27,049,963 (GRCm39) H305L probably benign Het
Spag9 T C 11: 93,959,801 (GRCm39) I187T probably damaging Het
Srp72 C A 5: 77,135,838 (GRCm39) T256K probably damaging Het
Stk32c T A 7: 138,685,190 (GRCm39) N320I probably damaging Het
Stxbp4 A T 11: 90,497,811 (GRCm39) S163T probably benign Het
Tpk1 T C 6: 43,445,961 (GRCm39) D159G probably benign Het
Trav21-dv12 C T 14: 54,114,191 (GRCm39) H104Y probably benign Het
Trip4 A T 9: 65,788,302 (GRCm39) Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 (GRCm39) T255A possibly damaging Het
Ttn G A 2: 76,747,232 (GRCm39) Q4606* probably null Het
Vcan T A 13: 89,838,806 (GRCm39) K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 (GRCm39) G452C probably damaging Het
Zfp54 T A 17: 21,654,004 (GRCm39) I166N probably benign Het
Zfp735 T C 11: 73,602,478 (GRCm39) V474A probably benign Het
Zfp831 G T 2: 174,488,360 (GRCm39) G1012W possibly damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102,748,278 (GRCm39) missense probably benign
IGL00833:Sycp1 APN 3 102,783,617 (GRCm39) critical splice donor site probably null
IGL01066:Sycp1 APN 3 102,827,950 (GRCm39) missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102,823,183 (GRCm39) missense probably benign 0.01
IGL02139:Sycp1 APN 3 102,772,430 (GRCm39) missense probably benign 0.00
IGL02270:Sycp1 APN 3 102,803,259 (GRCm39) missense probably benign 0.12
IGL02347:Sycp1 APN 3 102,800,863 (GRCm39) missense probably benign 0.00
IGL02630:Sycp1 APN 3 102,786,080 (GRCm39) splice site probably benign
IGL02668:Sycp1 APN 3 102,727,847 (GRCm39) splice site probably benign
IGL02928:Sycp1 APN 3 102,726,134 (GRCm39) utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102,842,149 (GRCm39) missense probably benign 0.01
R0027:Sycp1 UTSW 3 102,803,226 (GRCm39) missense probably benign
R0282:Sycp1 UTSW 3 102,823,111 (GRCm39) splice site probably benign
R0462:Sycp1 UTSW 3 102,726,422 (GRCm39) missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102,806,165 (GRCm39) splice site probably null
R0837:Sycp1 UTSW 3 102,822,561 (GRCm39) missense probably benign 0.17
R1301:Sycp1 UTSW 3 102,827,938 (GRCm39) missense probably benign 0.02
R2408:Sycp1 UTSW 3 102,832,575 (GRCm39) missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102,832,522 (GRCm39) missense probably benign 0.15
R2516:Sycp1 UTSW 3 102,752,382 (GRCm39) missense probably benign 0.09
R2880:Sycp1 UTSW 3 102,726,214 (GRCm39) missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102,748,357 (GRCm39) missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102,783,666 (GRCm39) missense probably benign 0.00
R4538:Sycp1 UTSW 3 102,748,278 (GRCm39) missense probably benign
R4679:Sycp1 UTSW 3 102,829,778 (GRCm39) critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102,760,805 (GRCm39) missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102,760,805 (GRCm39) missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102,803,303 (GRCm39) splice site probably null
R5036:Sycp1 UTSW 3 102,727,916 (GRCm39) missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102,752,370 (GRCm39) missense probably benign 0.03
R5070:Sycp1 UTSW 3 102,827,881 (GRCm39) missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102,786,116 (GRCm39) missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102,841,569 (GRCm39) missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102,748,363 (GRCm39) splice site probably null
R5477:Sycp1 UTSW 3 102,726,206 (GRCm39) missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102,726,218 (GRCm39) missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102,803,213 (GRCm39) missense probably benign 0.03
R6291:Sycp1 UTSW 3 102,816,277 (GRCm39) missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102,806,203 (GRCm39) missense probably benign 0.09
R6870:Sycp1 UTSW 3 102,842,919 (GRCm39) missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102,748,296 (GRCm39) missense probably benign
R7037:Sycp1 UTSW 3 102,806,250 (GRCm39) missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102,760,808 (GRCm39) missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102,832,543 (GRCm39) missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102,820,749 (GRCm39) missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102,803,278 (GRCm39) missense probably benign 0.00
R7858:Sycp1 UTSW 3 102,806,273 (GRCm39) missense probably benign 0.09
R7909:Sycp1 UTSW 3 102,727,942 (GRCm39) nonsense probably null
R8109:Sycp1 UTSW 3 102,758,918 (GRCm39) missense probably benign 0.21
R8141:Sycp1 UTSW 3 102,842,885 (GRCm39) missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102,748,353 (GRCm39) missense probably benign 0.01
R8359:Sycp1 UTSW 3 102,727,909 (GRCm39) missense probably damaging 0.98
R8844:Sycp1 UTSW 3 102,772,421 (GRCm39) missense probably damaging 1.00
R9020:Sycp1 UTSW 3 102,783,653 (GRCm39) missense probably benign 0.01
R9149:Sycp1 UTSW 3 102,758,944 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATTCAACCATGCATCAATAA -3'
(R):5'- CAGGCCAGTGAGTTTATGATTTT -3'

Sequencing Primer
(F):5'- AGCTATCACTCTTTCTGCTTAG -3'
(R):5'- GCAATGCCAGTTACAGTTCAG -3'
Posted On 2018-05-21