Incidental Mutation 'R6460:Sycp1'
ID517551
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.463) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102925253 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 199 (Y199S)
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988] [ENSMUST00000199930]
Predicted Effect probably damaging
Transcript: ENSMUST00000029448
AA Change: Y199S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: Y199S

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196988
AA Change: Y199S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: Y199S

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199930
AA Change: Y144S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143493
Gene: ENSMUSG00000027855
AA Change: Y144S

DomainStartEndE-ValueType
Pfam:SCP-1 28 95 2e-33 PFAM
Pfam:SCP-1 93 182 9.8e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R7941:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7990:Sycp1 UTSW 3 102820626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGATTCAACCATGCATCAATAA -3'
(R):5'- CAGGCCAGTGAGTTTATGATTTT -3'

Sequencing Primer
(F):5'- AGCTATCACTCTTTCTGCTTAG -3'
(R):5'- GCAATGCCAGTTACAGTTCAG -3'
Posted On2018-05-21