Incidental Mutation 'R6460:Pom121'
ID517559
Institutional Source Beutler Lab
Gene Symbol Pom121
Ensembl Gene ENSMUSG00000053293
Gene Namenuclear pore membrane protein 121
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135376141-135394546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135391683 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 295 (K295E)
Ref Sequence ENSEMBL: ENSMUSP00000106801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111171]
Predicted Effect unknown
Transcript: ENSMUST00000111171
AA Change: K295E
SMART Domains Protein: ENSMUSP00000106801
Gene: ENSMUSG00000053293
AA Change: K295E

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 147 165 N/A INTRINSIC
low complexity region 174 188 N/A INTRINSIC
Pfam:POM121 292 527 1.3e-111 PFAM
low complexity region 541 551 N/A INTRINSIC
low complexity region 552 576 N/A INTRINSIC
low complexity region 581 602 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
low complexity region 681 699 N/A INTRINSIC
low complexity region 715 742 N/A INTRINSIC
low complexity region 767 776 N/A INTRINSIC
low complexity region 782 800 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
internal_repeat_4 827 861 8.15e-5 PROSPERO
low complexity region 874 904 N/A INTRINSIC
internal_repeat_3 905 952 5.01e-5 PROSPERO
internal_repeat_1 917 961 1.66e-6 PROSPERO
low complexity region 963 979 N/A INTRINSIC
low complexity region 1002 1048 N/A INTRINSIC
low complexity region 1050 1099 N/A INTRINSIC
internal_repeat_2 1104 1144 4.39e-6 PROSPERO
internal_repeat_1 1114 1155 1.66e-6 PROSPERO
internal_repeat_4 1125 1164 8.15e-5 PROSPERO
internal_repeat_3 1126 1175 5.01e-5 PROSPERO
internal_repeat_2 1142 1178 4.39e-6 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Pom121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pom121 APN 5 135391706 missense unknown
IGL01537:Pom121 APN 5 135392535 splice site probably benign
IGL01611:Pom121 APN 5 135383672 missense unknown
IGL01803:Pom121 APN 5 135381609 unclassified probably benign
IGL02666:Pom121 APN 5 135386832 missense unknown
IGL03382:Pom121 APN 5 135392407 missense unknown
IGL03134:Pom121 UTSW 5 135382081 missense unknown
R0511:Pom121 UTSW 5 135381832 missense unknown
R1935:Pom121 UTSW 5 135383886 missense unknown
R1967:Pom121 UTSW 5 135391754 missense unknown
R2024:Pom121 UTSW 5 135381550 unclassified probably benign
R4082:Pom121 UTSW 5 135388637 missense unknown
R4477:Pom121 UTSW 5 135381988 missense unknown
R5655:Pom121 UTSW 5 135392317 missense unknown
R6807:Pom121 UTSW 5 135381124 unclassified probably benign
R6914:Pom121 UTSW 5 135378157 missense probably damaging 1.00
R7272:Pom121 UTSW 5 135381087 missense unknown
R7726:Pom121 UTSW 5 135378148 missense probably damaging 1.00
R7886:Pom121 UTSW 5 135381994 missense unknown
R7969:Pom121 UTSW 5 135381994 missense unknown
Predicted Primers PCR Primer
(F):5'- TAAAGCCTTGTTACCACGCTGC -3'
(R):5'- TGAGCCAAGGTCTTGCTTAGC -3'

Sequencing Primer
(F):5'- TGTTACCACGCTGCTCCAAGG -3'
(R):5'- AGCCAAGGTCTTGCTTAGCTTCTAG -3'
Posted On2018-05-21