Incidental Mutation 'R6460:Emg1'
ID517562
Institutional Source Beutler Lab
Gene Symbol Emg1
Ensembl Gene ENSMUSG00000004268
Gene NameEMG1 N1-specific pseudouridine methyltransferase
SynonymsGrcc2f
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124704085-124712178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124711907 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 46 (V46A)
Ref Sequence ENSEMBL: ENSMUSP00000004379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004375] [ENSMUST00000004379] [ENSMUST00000147974] [ENSMUST00000203238]
Predicted Effect probably benign
Transcript: ENSMUST00000004375
SMART Domains Protein: ENSMUSP00000004375
Gene: ENSMUSG00000004264

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
PHB 39 201 1.01e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000004379
AA Change: V46A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004379
Gene: ENSMUSG00000004268
AA Change: V46A

DomainStartEndE-ValueType
Pfam:EMG1 45 238 2.9e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129422
Predicted Effect probably benign
Transcript: ENSMUST00000130279
SMART Domains Protein: ENSMUSP00000121535
Gene: ENSMUSG00000004264

DomainStartEndE-ValueType
Blast:PHB 2 82 5e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145447
Predicted Effect probably benign
Transcript: ENSMUST00000147974
SMART Domains Protein: ENSMUSP00000119316
Gene: ENSMUSG00000004264

DomainStartEndE-ValueType
PHB 1 103 3.22e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158210
Predicted Effect possibly damaging
Transcript: ENSMUST00000203238
AA Change: V46A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144730
Gene: ENSMUSG00000004268
AA Change: V46A

DomainStartEndE-ValueType
Pfam:EMG1 55 122 1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204334
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential, conserved eukaryotic protein that methylates pseudouridine in 18S rRNA. The related protein in yeast is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter allele fail to form blastocele and die after E3.5. Mice homozygous for another allele exhibit lethality between E8.5 and E12.5, growth retardation, defective enural tube closure, increased cell apoptosis and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Emg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Emg1 APN 6 124705070 missense probably benign 0.38
IGL01724:Emg1 APN 6 124712021 missense possibly damaging 0.59
IGL02377:Emg1 APN 6 124704657 missense probably benign 0.03
IGL03005:Emg1 APN 6 124704594 missense probably damaging 0.99
R2887:Emg1 UTSW 6 124705063 missense probably damaging 1.00
R3911:Emg1 UTSW 6 124705046 missense probably benign 0.00
R7161:Emg1 UTSW 6 124705749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAGGATATCAACAGCCTG -3'
(R):5'- TCAAAATGGCAGCTCGAAGG -3'

Sequencing Primer
(F):5'- CCTGGAAAACTAGGTCATTCTTCCAG -3'
(R):5'- AGTTCTAACTTAAGGACTTCGGTGC -3'
Posted On2018-05-21