Mutagenetix > Incidental Mutations

Incidental Mutation 'R6460:Muc16'

517572

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R6460 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18640516 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 4827 (I4827T)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: I4827T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	T	10: 80,009,028	H1528L	probably benign	Het
Ablim1	A	G	19: 57,079,839	S263P	possibly damaging	Het
Ahnak2	T	C	12: 112,786,990	E104G	probably null	Het
Apof	T	A	10: 128,269,217	M80K	probably damaging	Het
Arfgef1	C	T	1: 10,213,060	R208H	probably damaging	Het
Arhgef33	A	G	17: 80,349,589		probably null	Het
Atxn2l	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	7: 126,494,248		probably benign	Het
Cabcoco1	T	C	10: 68,516,381	K34E	probably damaging	Het
Col4a4	C	A	1: 82,466,532	G1338V	unknown	Het
Coq9	T	A	8: 94,853,186	D256E	probably damaging	Het
Dnajc18	A	T	18: 35,700,910	C41S	probably benign	Het
Dnajc6	A	G	4: 101,615,598	I307M	probably damaging	Het
Emg1	A	G	6: 124,711,907	V46A	probably damaging	Het
Eya3	A	G	4: 132,680,863	S157G	probably damaging	Het
Eya4	T	C	10: 23,152,012	N274S	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat3	A	G	9: 15,967,000	V3395A	probably damaging	Het
Fchsd1	A	T	18: 37,959,844		probably null	Het
Gm4846	A	G	1: 166,497,513	V3A	probably benign	Het
Hecw2	T	A	1: 53,868,833		probably null	Het
Herc3	T	A	6: 58,890,123	I10N	probably damaging	Het
Hhatl	C	T	9: 121,789,522	R138H	probably benign	Het
Hspa9	A	T	18: 34,952,712	H35Q	probably benign	Het
Irgq	T	A	7: 24,533,690	S319T	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Ksr2	T	A	5: 117,756,384		probably null	Het
Lrriq1	T	C	10: 103,200,698	I865V	probably damaging	Het
Map2k1	A	G	9: 64,187,295	L355P	probably damaging	Het
Myh1	T	C	11: 67,221,376	V1752A	probably benign	Het
Nfatc2ip	A	G	7: 126,387,737	V282A	probably damaging	Het
Nrg1	T	A	8: 31,818,533	E485V	probably damaging	Het
Ofcc1	T	C	13: 40,287,979	D2G	probably damaging	Het
Olfr958	CAGAG	CAG	9: 39,550,792		probably null	Het
Pclo	T	C	5: 14,679,132		probably benign	Het
Pom121	T	C	5: 135,391,683	K295E	unknown	Het
Rb1	A	C	14: 73,278,454	I294R	probably benign	Het
Schip1	C	A	3: 68,494,894	S101R	probably benign	Het
Sec24c	T	A	14: 20,690,800	Y629N	probably damaging	Het
Shkbp1	T	A	7: 27,350,538	H305L	probably benign	Het
Spag9	T	C	11: 94,068,975	I187T	probably damaging	Het
Srp72	C	A	5: 76,987,991	T256K	probably damaging	Het
Stk32c	T	A	7: 139,105,274	N320I	probably damaging	Het
Stxbp4	A	T	11: 90,606,985	S163T	probably benign	Het
Sycp1	T	G	3: 102,925,253	Y199S	probably damaging	Het
Tpk1	T	C	6: 43,469,027	D159G	probably benign	Het
Trav21-dv12	C	T	14: 53,876,734	H104Y	probably benign	Het
Trip4	A	T	9: 65,881,020	Y48N	probably damaging	Het
Trmt10b	A	G	4: 45,314,322	T255A	possibly damaging	Het
Ttn	G	A	2: 76,916,888	Q4606*	probably null	Het
Vcan	T	A	13: 89,690,687	K2246M	possibly damaging	Het
Zfp438	C	A	18: 5,213,603	G452C	probably damaging	Het
Zfp54	T	A	17: 21,433,742	I166N	probably benign	Het
Zfp735	T	C	11: 73,711,652	V474A	probably benign	Het
Zfp831	G	T	2: 174,646,567	G1012W	possibly damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CAGGGAAAGTTGAAGTCATTGC -3'
(R):5'- TGGGCAACAGACTTCAGTC -3'

Sequencing Primer
(F):5'- GCCTAAGTCAGTGAATTGTGATG -3'
(R):5'- GTCATGTCTATTTTTCCTTTTTCTCC -3'

Posted On

2018-05-21