Incidental Mutation 'R6460:Zfp735'
ID517583
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73711652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 474 (V474A)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect probably benign
Transcript: ENSMUST00000080407
AA Change: V474A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: V474A

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73711107 missense possibly damaging 0.86
R7866:Zfp735 UTSW 11 73710803 missense probably benign 0.00
R7949:Zfp735 UTSW 11 73710803 missense probably benign 0.00
R8005:Zfp735 UTSW 11 73712314 nonsense probably null
Z1176:Zfp735 UTSW 11 73710815 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCGGGATATGATAAGTCCTTGAATTTC -3'
(R):5'- AAAGTTCCTGTGCAGTGTGTATTC -3'

Sequencing Primer
(F):5'- GTGTCAAATCTCTTGGGAC -3'
(R):5'- CTGTGGTGAGCTTGAAGTTTTGAAG -3'
Posted On2018-05-21