Incidental Mutation 'R6460:Stxbp4'
ID517584
Institutional Source Beutler Lab
Gene Symbol Stxbp4
Ensembl Gene ENSMUSG00000020546
Gene Namesyntaxin binding protein 4
SynonymsSynip, 6030470M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location90476492-90638084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90606985 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 163 (S163T)
Ref Sequence ENSEMBL: ENSMUSP00000116191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000107872] [ENSMUST00000107875] [ENSMUST00000143203]
Predicted Effect probably benign
Transcript: ENSMUST00000020858
AA Change: S163T

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546
AA Change: S163T

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
low complexity region 504 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107872
AA Change: S163T

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103504
Gene: ENSMUSG00000020546
AA Change: S163T

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107875
AA Change: S163T

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103507
Gene: ENSMUSG00000020546
AA Change: S163T

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143203
AA Change: S163T

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546
AA Change: S163T

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
WW 501 533 1.11e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Stxbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Stxbp4 APN 11 90535512 missense probably benign 0.00
IGL01312:Stxbp4 APN 11 90621649 splice site probably benign
IGL01313:Stxbp4 APN 11 90621649 splice site probably benign
IGL01314:Stxbp4 APN 11 90621649 splice site probably benign
IGL01316:Stxbp4 APN 11 90621649 splice site probably benign
IGL01377:Stxbp4 APN 11 90621649 splice site probably benign
IGL01380:Stxbp4 APN 11 90621649 splice site probably benign
IGL01385:Stxbp4 APN 11 90540248 missense possibly damaging 0.95
IGL01408:Stxbp4 APN 11 90621649 splice site probably benign
IGL02573:Stxbp4 APN 11 90540269 missense probably damaging 0.99
IGL02707:Stxbp4 APN 11 90537933 missense probably benign 0.00
IGL02809:Stxbp4 APN 11 90600184 critical splice donor site probably null
IGL02900:Stxbp4 APN 11 90607035 missense probably benign 0.03
IGL03177:Stxbp4 APN 11 90571753 missense probably benign 0.01
IGL03397:Stxbp4 APN 11 90540234 missense probably damaging 1.00
IGL02799:Stxbp4 UTSW 11 90494600 critical splice donor site probably null
IGL03134:Stxbp4 UTSW 11 90607184 missense probably damaging 0.98
R0005:Stxbp4 UTSW 11 90548917 missense possibly damaging 0.78
R0487:Stxbp4 UTSW 11 90592360 missense probably benign 0.00
R0930:Stxbp4 UTSW 11 90621700 start codon destroyed probably null 0.99
R1633:Stxbp4 UTSW 11 90540160 splice site probably benign
R3785:Stxbp4 UTSW 11 90535615 critical splice acceptor site probably null
R4359:Stxbp4 UTSW 11 90494644 nonsense probably null
R4591:Stxbp4 UTSW 11 90594780 missense probably benign 0.33
R4756:Stxbp4 UTSW 11 90607371 missense probably damaging 1.00
R5095:Stxbp4 UTSW 11 90548975 missense probably benign 0.00
R5870:Stxbp4 UTSW 11 90537956 missense possibly damaging 0.89
R6268:Stxbp4 UTSW 11 90540201 nonsense probably null
R6479:Stxbp4 UTSW 11 90619187 missense probably damaging 0.99
R7139:Stxbp4 UTSW 11 90607009 nonsense probably null
R7349:Stxbp4 UTSW 11 90592111 intron probably null
R7481:Stxbp4 UTSW 11 90594813 missense possibly damaging 0.94
R7812:Stxbp4 UTSW 11 90594828 missense probably damaging 1.00
V8831:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1176:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90592331 critical splice donor site probably null
Z1177:Stxbp4 UTSW 11 90600146 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTGCGTTAGCTTGAAGATC -3'
(R):5'- TAGGTCAGAATCTCCCTGGG -3'

Sequencing Primer
(F):5'- GCGTTAGCTTGAAGATCTGTTTTAC -3'
(R):5'- TCCCTGGGAGATAGCATTCATCAG -3'
Posted On2018-05-21