Incidental Mutation 'R6460:Trav21-dv12'
ID517590
Institutional Source Beutler Lab
Gene Symbol Trav21-dv12
Ensembl Gene ENSMUSG00000076863
Gene NameT cell receptor alpha variable 21-DV12
SynonymsGm13892
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6460 (G1)
Quality Score180.009
Status Not validated
Chromosome14
Chromosomal Location53875984-53876751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53876734 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 104 (H104Y)
Ref Sequence ENSEMBL: ENSMUSP00000137998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103676] [ENSMUST00000180938] [ENSMUST00000187163]
Predicted Effect probably benign
Transcript: ENSMUST00000103676
SMART Domains Protein: ENSMUSP00000100453
Gene: ENSMUSG00000076864

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ig 26 112 6.7e-7 PFAM
Pfam:V-set 26 112 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180938
AA Change: H104Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137998
Gene: ENSMUSG00000076863
AA Change: H104Y

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:V-set 18 108 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187163
SMART Domains Protein: ENSMUSP00000139783
Gene: ENSMUSG00000076864

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG_like 37 110 6.4e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Trav21-dv12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Trav21-dv12 APN 14 53876650 missense probably benign 0.36
IGL01599:Trav21-dv12 APN 14 53876731 missense probably damaging 1.00
IGL02185:Trav21-dv12 APN 14 53876498 missense probably benign 0.00
IGL03342:Trav21-dv12 APN 14 53876044 missense unknown
R4819:Trav21-dv12 UTSW 14 53876613 nonsense probably null
R7327:Trav21-dv12 UTSW 14 53876057 critical splice donor site probably benign
R7398:Trav21-dv12 UTSW 14 53876705 missense probably benign 0.02
R7547:Trav21-dv12 UTSW 14 53876615 missense probably damaging 0.96
R7592:Trav21-dv12 UTSW 14 53876540 missense probably damaging 1.00
R8059:Trav21-dv12 UTSW 14 53876721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTGCACTTGCCTTGTAG -3'
(R):5'- TTGCCCAGTCGCAGAATCTC -3'

Sequencing Primer
(F):5'- GCACTTGCCTTGTAGCCACG -3'
(R):5'- AGTCGCAGAATCTCTTTCTCC -3'
Posted On2018-05-21