Incidental Mutation 'R6460:Zfp438'
ID517593
Institutional Source Beutler Lab
Gene Symbol Zfp438
Ensembl Gene ENSMUSG00000050945
Gene Namezinc finger protein 438
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location5210031-5334439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5213603 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 452 (G452C)
Ref Sequence ENSEMBL: ENSMUSP00000067049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063989]
Predicted Effect probably damaging
Transcript: ENSMUST00000063989
AA Change: G452C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067049
Gene: ENSMUSG00000050945
AA Change: G452C

DomainStartEndE-ValueType
low complexity region 132 151 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
ZnF_C2H2 493 515 5.72e-1 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 553 576 5.2e0 SMART
ZnF_C2H2 635 658 1.86e1 SMART
ZnF_C2H2 746 769 1.13e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc18 A T 18: 35,700,910 C41S probably benign Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Zfp438
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Zfp438 APN 18 5213815 missense probably damaging 1.00
IGL01967:Zfp438 APN 18 5214049 missense probably benign 0.00
IGL02003:Zfp438 APN 18 5214503 missense probably benign 0.15
IGL02305:Zfp438 APN 18 5213674 missense possibly damaging 0.84
IGL02439:Zfp438 APN 18 5213216 missense probably damaging 1.00
IGL02744:Zfp438 APN 18 5214760 missense probably benign 0.03
IGL02836:Zfp438 APN 18 5245427 utr 5 prime probably benign
R0308:Zfp438 UTSW 18 5213638 missense probably benign 0.00
R0437:Zfp438 UTSW 18 5214910 missense probably damaging 0.97
R1540:Zfp438 UTSW 18 5210740 missense probably benign 0.04
R1594:Zfp438 UTSW 18 5213515 missense possibly damaging 0.94
R1804:Zfp438 UTSW 18 5213689 missense probably damaging 1.00
R2057:Zfp438 UTSW 18 5214085 missense probably benign 0.03
R2256:Zfp438 UTSW 18 5213508 missense probably damaging 0.99
R4549:Zfp438 UTSW 18 5214073 missense probably benign 0.01
R4747:Zfp438 UTSW 18 5214403 missense probably benign 0.00
R4858:Zfp438 UTSW 18 5213154 missense probably benign 0.01
R4887:Zfp438 UTSW 18 5213776 missense possibly damaging 0.55
R5543:Zfp438 UTSW 18 5213761 missense probably damaging 1.00
R5646:Zfp438 UTSW 18 5214526 missense probably benign 0.36
R6022:Zfp438 UTSW 18 5213419 missense probably damaging 1.00
R6058:Zfp438 UTSW 18 5213209 missense probably damaging 1.00
R6703:Zfp438 UTSW 18 5214044 missense probably benign 0.05
R6766:Zfp438 UTSW 18 5213780 missense probably benign 0.07
R7252:Zfp438 UTSW 18 5214874 nonsense probably null
R7283:Zfp438 UTSW 18 5214712 missense probably damaging 1.00
R7429:Zfp438 UTSW 18 5214139 missense probably benign 0.01
R7769:Zfp438 UTSW 18 5213377 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CGCAACTATAAGGCCGTCTG -3'
(R):5'- GAGATTTTAGCATTGCAGGGC -3'

Sequencing Primer
(F):5'- CAACTATAAGGCCGTCTGTTGGTG -3'
(R):5'- AGGAGGAAATGCATTATTGGTATGTG -3'
Posted On2018-05-21