Mutagenetix > Incidental Mutations

Incidental Mutation 'R6460:Hspa9'

517594

Institutional Source

Beutler Lab

Gene Symbol

Hspa9

Ensembl Gene

ENSMUSG00000024359

Gene Name

heat shock protein 9

Synonyms

C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R6460 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34937414-34954357 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34952712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 35 (H35Q)

Ref Sequence

ENSEMBL: ENSMUSP00000025217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025217]

AlphaFold

P38647

Predicted Effect

probably benign
Transcript: ENSMUST00000025217
AA Change: H35Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: H35Q

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Pfam:HSP70	55	653	2.7e-270	PFAM
Pfam:FGGY_C	283	429	3e-8	PFAM
low complexity region	657	679	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173806

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	T	10: 80,009,028	H1528L	probably benign	Het
Ablim1	A	G	19: 57,079,839	S263P	possibly damaging	Het
Ahnak2	T	C	12: 112,786,990	E104G	probably null	Het
Apof	T	A	10: 128,269,217	M80K	probably damaging	Het
Arfgef1	C	T	1: 10,213,060	R208H	probably damaging	Het
Arhgef33	A	G	17: 80,349,589		probably null	Het
Atxn2l	CCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGC	7: 126,494,248		probably benign	Het
Cabcoco1	T	C	10: 68,516,381	K34E	probably damaging	Het
Col4a4	C	A	1: 82,466,532	G1338V	unknown	Het
Coq9	T	A	8: 94,853,186	D256E	probably damaging	Het
Dnajc18	A	T	18: 35,700,910	C41S	probably benign	Het
Dnajc6	A	G	4: 101,615,598	I307M	probably damaging	Het
Emg1	A	G	6: 124,711,907	V46A	probably damaging	Het
Eya3	A	G	4: 132,680,863	S157G	probably damaging	Het
Eya4	T	C	10: 23,152,012	N274S	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat3	A	G	9: 15,967,000	V3395A	probably damaging	Het
Fchsd1	A	T	18: 37,959,844		probably null	Het
Gm4846	A	G	1: 166,497,513	V3A	probably benign	Het
Hecw2	T	A	1: 53,868,833		probably null	Het
Herc3	T	A	6: 58,890,123	I10N	probably damaging	Het
Hhatl	C	T	9: 121,789,522	R138H	probably benign	Het
Irgq	T	A	7: 24,533,690	S319T	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Ksr2	T	A	5: 117,756,384		probably null	Het
Lrriq1	T	C	10: 103,200,698	I865V	probably damaging	Het
Map2k1	A	G	9: 64,187,295	L355P	probably damaging	Het
Muc16	A	G	9: 18,640,516	I4827T	probably benign	Het
Myh1	T	C	11: 67,221,376	V1752A	probably benign	Het
Nfatc2ip	A	G	7: 126,387,737	V282A	probably damaging	Het
Nrg1	T	A	8: 31,818,533	E485V	probably damaging	Het
Ofcc1	T	C	13: 40,287,979	D2G	probably damaging	Het
Olfr958	CAGAG	CAG	9: 39,550,792		probably null	Het
Pclo	T	C	5: 14,679,132		probably benign	Het
Pom121	T	C	5: 135,391,683	K295E	unknown	Het
Rb1	A	C	14: 73,278,454	I294R	probably benign	Het
Schip1	C	A	3: 68,494,894	S101R	probably benign	Het
Sec24c	T	A	14: 20,690,800	Y629N	probably damaging	Het
Shkbp1	T	A	7: 27,350,538	H305L	probably benign	Het
Spag9	T	C	11: 94,068,975	I187T	probably damaging	Het
Srp72	C	A	5: 76,987,991	T256K	probably damaging	Het
Stk32c	T	A	7: 139,105,274	N320I	probably damaging	Het
Stxbp4	A	T	11: 90,606,985	S163T	probably benign	Het
Sycp1	T	G	3: 102,925,253	Y199S	probably damaging	Het
Tpk1	T	C	6: 43,469,027	D159G	probably benign	Het
Trav21-dv12	C	T	14: 53,876,734	H104Y	probably benign	Het
Trip4	A	T	9: 65,881,020	Y48N	probably damaging	Het
Trmt10b	A	G	4: 45,314,322	T255A	possibly damaging	Het
Ttn	G	A	2: 76,916,888	Q4606*	probably null	Het
Vcan	T	A	13: 89,690,687	K2246M	possibly damaging	Het
Zfp438	C	A	18: 5,213,603	G452C	probably damaging	Het
Zfp54	T	A	17: 21,433,742	I166N	probably benign	Het
Zfp735	T	C	11: 73,711,652	V474A	probably benign	Het
Zfp831	G	T	2: 174,646,567	G1012W	possibly damaging	Het

Other mutations in Hspa9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Hspa9	APN	18	34938580	splice site	probably benign
IGL01939:Hspa9	APN	18	34938708	missense	possibly damaging	0.89
IGL02008:Hspa9	APN	18	34947975	nonsense	probably null
IGL02604:Hspa9	APN	18	34954213	missense	unknown
Chiri-san	UTSW	18	34939423	missense	probably damaging	1.00
R0238:Hspa9	UTSW	18	34946646	nonsense	probably null
R0238:Hspa9	UTSW	18	34946646	nonsense	probably null
R0278:Hspa9	UTSW	18	34940910	missense	possibly damaging	0.50
R0613:Hspa9	UTSW	18	34947980	missense	probably damaging	1.00
R1414:Hspa9	UTSW	18	34938591	missense	probably damaging	1.00
R1454:Hspa9	UTSW	18	34938606	missense	probably damaging	1.00
R2013:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2014:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2015:Hspa9	UTSW	18	34946648	missense	probably damaging	1.00
R2936:Hspa9	UTSW	18	34948014	missense	probably damaging	1.00
R4261:Hspa9	UTSW	18	34939423	missense	probably damaging	1.00
R4622:Hspa9	UTSW	18	34949037	missense	possibly damaging	0.48
R4819:Hspa9	UTSW	18	34939388	missense	probably damaging	0.98
R5056:Hspa9	UTSW	18	34938681	missense	probably damaging	1.00
R5223:Hspa9	UTSW	18	34952671	splice site	probably null
R5666:Hspa9	UTSW	18	34954247	missense	probably null
R5820:Hspa9	UTSW	18	34943174	missense	possibly damaging	0.82
R5944:Hspa9	UTSW	18	34949023	missense	possibly damaging	0.94
R7404:Hspa9	UTSW	18	34943276	missense	possibly damaging	0.76
R7412:Hspa9	UTSW	18	34949029	missense	probably damaging	1.00
R7637:Hspa9	UTSW	18	34938687	missense	not run
R8524:Hspa9	UTSW	18	34954244	missense	unknown
R8830:Hspa9	UTSW	18	34948104	critical splice donor site	probably null
R8987:Hspa9	UTSW	18	34947929	missense	probably damaging	1.00
R9028:Hspa9	UTSW	18	34942031	missense	probably damaging	1.00
R9184:Hspa9	UTSW	18	34949115	missense	possibly damaging	0.87
Z1177:Hspa9	UTSW	18	34943145	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACCACTGCACCCTTGATTGC -3'
(R):5'- CTGGAAAACTTGTAGATGTGTGATG -3'

Sequencing Primer
(F):5'- TCTGAACAGTGGTCTCCAATACG -3'
(R):5'- GATGTGTGATGTATAGCTCAACC -3'

Posted On

2018-05-21