Incidental Mutation 'R6460:Dnajc18'
ID517595
Institutional Source Beutler Lab
Gene Symbol Dnajc18
Ensembl Gene ENSMUSG00000024350
Gene NameDnaJ heat shock protein family (Hsp40) member C18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R6460 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location35671103-35703144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35700910 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 41 (C41S)
Ref Sequence ENSEMBL: ENSMUSP00000025208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025208]
Predicted Effect probably benign
Transcript: ENSMUST00000025208
AA Change: C41S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025208
Gene: ENSMUSG00000024350
AA Change: C41S

DomainStartEndE-ValueType
DnaJ 81 138 6.52e-27 SMART
low complexity region 200 218 N/A INTRINSIC
Pfam:DUF1977 243 349 1.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,028 H1528L probably benign Het
Ablim1 A G 19: 57,079,839 S263P possibly damaging Het
Ahnak2 T C 12: 112,786,990 E104G probably null Het
Apof T A 10: 128,269,217 M80K probably damaging Het
Arfgef1 C T 1: 10,213,060 R208H probably damaging Het
Arhgef33 A G 17: 80,349,589 probably null Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
Cabcoco1 T C 10: 68,516,381 K34E probably damaging Het
Col4a4 C A 1: 82,466,532 G1338V unknown Het
Coq9 T A 8: 94,853,186 D256E probably damaging Het
Dnajc6 A G 4: 101,615,598 I307M probably damaging Het
Emg1 A G 6: 124,711,907 V46A probably damaging Het
Eya3 A G 4: 132,680,863 S157G probably damaging Het
Eya4 T C 10: 23,152,012 N274S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 A G 9: 15,967,000 V3395A probably damaging Het
Fchsd1 A T 18: 37,959,844 probably null Het
Gm4846 A G 1: 166,497,513 V3A probably benign Het
Hecw2 T A 1: 53,868,833 probably null Het
Herc3 T A 6: 58,890,123 I10N probably damaging Het
Hhatl C T 9: 121,789,522 R138H probably benign Het
Hspa9 A T 18: 34,952,712 H35Q probably benign Het
Irgq T A 7: 24,533,690 S319T probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ksr2 T A 5: 117,756,384 probably null Het
Lrriq1 T C 10: 103,200,698 I865V probably damaging Het
Map2k1 A G 9: 64,187,295 L355P probably damaging Het
Muc16 A G 9: 18,640,516 I4827T probably benign Het
Myh1 T C 11: 67,221,376 V1752A probably benign Het
Nfatc2ip A G 7: 126,387,737 V282A probably damaging Het
Nrg1 T A 8: 31,818,533 E485V probably damaging Het
Ofcc1 T C 13: 40,287,979 D2G probably damaging Het
Olfr958 CAGAG CAG 9: 39,550,792 probably null Het
Pclo T C 5: 14,679,132 probably benign Het
Pom121 T C 5: 135,391,683 K295E unknown Het
Rb1 A C 14: 73,278,454 I294R probably benign Het
Schip1 C A 3: 68,494,894 S101R probably benign Het
Sec24c T A 14: 20,690,800 Y629N probably damaging Het
Shkbp1 T A 7: 27,350,538 H305L probably benign Het
Spag9 T C 11: 94,068,975 I187T probably damaging Het
Srp72 C A 5: 76,987,991 T256K probably damaging Het
Stk32c T A 7: 139,105,274 N320I probably damaging Het
Stxbp4 A T 11: 90,606,985 S163T probably benign Het
Sycp1 T G 3: 102,925,253 Y199S probably damaging Het
Tpk1 T C 6: 43,469,027 D159G probably benign Het
Trav21-dv12 C T 14: 53,876,734 H104Y probably benign Het
Trip4 A T 9: 65,881,020 Y48N probably damaging Het
Trmt10b A G 4: 45,314,322 T255A possibly damaging Het
Ttn G A 2: 76,916,888 Q4606* probably null Het
Vcan T A 13: 89,690,687 K2246M possibly damaging Het
Zfp438 C A 18: 5,213,603 G452C probably damaging Het
Zfp54 T A 17: 21,433,742 I166N probably benign Het
Zfp735 T C 11: 73,711,652 V474A probably benign Het
Zfp831 G T 2: 174,646,567 G1012W possibly damaging Het
Other mutations in Dnajc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Dnajc18 APN 18 35680942 splice site probably benign
IGL01152:Dnajc18 APN 18 35680873 missense probably benign 0.02
IGL01621:Dnajc18 APN 18 35680840 missense probably benign
IGL03201:Dnajc18 APN 18 35680919 missense probably benign 0.19
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1801:Dnajc18 UTSW 18 35680804 missense probably damaging 1.00
R3893:Dnajc18 UTSW 18 35700995 splice site probably null
R4974:Dnajc18 UTSW 18 35683319 missense possibly damaging 0.75
R5234:Dnajc18 UTSW 18 35683298 missense probably benign 0.12
R6326:Dnajc18 UTSW 18 35680925 missense possibly damaging 0.95
R6360:Dnajc18 UTSW 18 35686709 missense probably damaging 1.00
R7215:Dnajc18 UTSW 18 35681981 missense probably benign
R7492:Dnajc18 UTSW 18 35686793 missense probably damaging 1.00
X0063:Dnajc18 UTSW 18 35686733 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTACACAGCCCATCCTGAG -3'
(R):5'- CAAAACTGTAGAGATGGGCTTCAG -3'

Sequencing Primer
(F):5'- AGGCAGGCCTTCTTCTGAG -3'
(R):5'- GCTTGTAATTCCAATGGTAAAGGAGC -3'
Posted On2018-05-21