Incidental Mutation 'R6461:Irf6'
ID517598
Institutional Source Beutler Lab
Gene Symbol Irf6
Ensembl Gene ENSMUSG00000026638
Gene Nameinterferon regulatory factor 6
SynonymsE230028I05Rik
MMRRC Submission 044390-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.759) question?
Stock #R6461 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location193153111-193172023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 193167471 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 234 (G234R)
Ref Sequence ENSEMBL: ENSMUSP00000075839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076521] [ENSMUST00000160822]
Predicted Effect probably damaging
Transcript: ENSMUST00000076521
AA Change: G234R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075839
Gene: ENSMUSG00000026638
AA Change: G234R

DomainStartEndE-ValueType
IRF 3 116 1.98e-59 SMART
low complexity region 135 151 N/A INTRINSIC
Blast:IRF 158 189 6e-8 BLAST
IRF-3 223 407 3.92e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140066
Predicted Effect probably benign
Transcript: ENSMUST00000160822
SMART Domains Protein: ENSMUSP00000124546
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 15 263 2.7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193772
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interferon regulatory transcription factor (IRF) family. Family members share a highly-conserved N-terminal helix-turn-helix DNA-binding domain and a less conserved C-terminal protein-binding domain. The encoded protein may be a transcriptional activator. Mutations in this gene can cause van der Woude syndrome and popliteal pterygium syndrome. Mutations in this gene are also associated with non-syndromic orofacial cleft type 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2011]
PHENOTYPE: Mice with mutations of Irf6 display craniofacial, limb, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp12a C T 14: 56,373,238 R280C probably damaging Het
Btbd11 T A 10: 85,640,564 I903N probably damaging Het
Dnmbp A G 19: 43,867,525 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fbxo40 T C 16: 36,970,028 E240G probably benign Het
Gne T C 4: 44,060,078 D105G probably damaging Het
Grin2c A T 11: 115,255,696 M494K possibly damaging Het
Hnrnpk A G 13: 58,393,194 probably null Het
Lman2 A G 13: 55,346,915 F347L probably damaging Het
Mcfd2 G A 17: 87,258,066 T3I probably benign Het
Mon1b A G 8: 113,638,538 D166G probably damaging Het
Mup10 T A 4: 60,582,079 M4L unknown Het
Olfr156 T C 4: 43,821,355 E2G probably benign Het
Olfr571 T A 7: 102,909,028 R270S possibly damaging Het
Olfr93 C T 17: 37,151,471 C167Y probably damaging Het
Papln A G 12: 83,781,813 probably null Het
Pelp1 A T 11: 70,396,306 V522E probably damaging Het
Scn1a T C 2: 66,326,122 D481G probably null Het
Scube1 G A 15: 83,612,427 T791I probably damaging Het
Sec24a T C 11: 51,713,546 I748V possibly damaging Het
Slc29a2 A G 19: 5,027,740 T236A probably benign Het
Smarca4 T A 9: 21,679,020 I1152N probably damaging Het
Syngap1 A G 17: 26,964,848 I1026V probably damaging Het
Tnxb G T 17: 34,671,898 R405L probably damaging Het
Zbtb11 G A 16: 56,006,871 R900H probably damaging Het
Zfp142 T C 1: 74,567,185 K1639R probably damaging Het
Other mutations in Irf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03269:Irf6 APN 1 193162598 splice site probably benign
R0068:Irf6 UTSW 1 193165759 unclassified probably benign
R1317:Irf6 UTSW 1 193169301 missense probably damaging 1.00
R1413:Irf6 UTSW 1 193169305 missense probably benign 0.22
R1761:Irf6 UTSW 1 193169301 missense probably damaging 1.00
R1856:Irf6 UTSW 1 193167535 missense probably benign 0.32
R3712:Irf6 UTSW 1 193162623 missense probably benign 0.00
R3941:Irf6 UTSW 1 193168549 missense probably benign 0.17
R4717:Irf6 UTSW 1 193167434 splice site probably null
R6530:Irf6 UTSW 1 193157349 missense probably damaging 1.00
R6577:Irf6 UTSW 1 193169354 missense probably damaging 1.00
R6883:Irf6 UTSW 1 193167466 missense probably damaging 1.00
R7116:Irf6 UTSW 1 193167597 missense probably damaging 1.00
R7698:Irf6 UTSW 1 193161767 missense probably damaging 1.00
R7887:Irf6 UTSW 1 193167732 missense probably damaging 1.00
R7894:Irf6 UTSW 1 193162713 missense probably benign 0.22
R8934:Irf6 UTSW 1 193162725 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGACTCCCCTGGGATATGTTG -3'
(R):5'- TGACATCCAACAGCTTGCTGG -3'

Sequencing Primer
(F):5'- GATACCTCCCTTTATTGCAGGAAGG -3'
(R):5'- TCCAACAGCTTGCTGGTGAAC -3'
Posted On2018-05-21