Incidental Mutation 'R6461:Sec24a'
ID517607
Institutional Source Beutler Lab
Gene Symbol Sec24a
Ensembl Gene ENSMUSG00000036391
Gene NameSec24 related gene family, member A (S. cerevisiae)
Synonyms9430090N21Rik
MMRRC Submission 044390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6461 (G1)
Quality Score212.009
Status Not validated
Chromosome11
Chromosomal Location51692264-51763634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51713546 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 748 (I748V)
Ref Sequence ENSEMBL: ENSMUSP00000104725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000109097]
Predicted Effect probably benign
Transcript: ENSMUST00000038210
AA Change: I747V

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: I747V

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 8e-19 PFAM
Pfam:Sec23_trunk 497 735 1.2e-87 PFAM
Pfam:Sec23_BS 740 824 1.1e-23 PFAM
Pfam:Sec23_helical 836 938 5.1e-27 PFAM
Pfam:Gelsolin 960 1035 7.2e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109097
AA Change: I748V

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: I748V

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 425 462 2.4e-16 PFAM
Pfam:Sec23_trunk 498 736 7.8e-87 PFAM
Pfam:Sec23_BS 741 825 1.1e-22 PFAM
Pfam:Sec23_helical 838 938 6.9e-28 PFAM
Pfam:Gelsolin 961 1036 9.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp12a C T 14: 56,373,238 R280C probably damaging Het
Btbd11 T A 10: 85,640,564 I903N probably damaging Het
Dnmbp A G 19: 43,867,525 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fbxo40 T C 16: 36,970,028 E240G probably benign Het
Gne T C 4: 44,060,078 D105G probably damaging Het
Grin2c A T 11: 115,255,696 M494K possibly damaging Het
Hnrnpk A G 13: 58,393,194 probably null Het
Irf6 G C 1: 193,167,471 G234R probably damaging Het
Lman2 A G 13: 55,346,915 F347L probably damaging Het
Mcfd2 G A 17: 87,258,066 T3I probably benign Het
Mon1b A G 8: 113,638,538 D166G probably damaging Het
Mup10 T A 4: 60,582,079 M4L unknown Het
Olfr156 T C 4: 43,821,355 E2G probably benign Het
Olfr571 T A 7: 102,909,028 R270S possibly damaging Het
Olfr93 C T 17: 37,151,471 C167Y probably damaging Het
Papln A G 12: 83,781,813 probably null Het
Pelp1 A T 11: 70,396,306 V522E probably damaging Het
Scn1a T C 2: 66,326,122 D481G probably null Het
Scube1 G A 15: 83,612,427 T791I probably damaging Het
Slc29a2 A G 19: 5,027,740 T236A probably benign Het
Smarca4 T A 9: 21,679,020 I1152N probably damaging Het
Syngap1 A G 17: 26,964,848 I1026V probably damaging Het
Tnxb G T 17: 34,671,898 R405L probably damaging Het
Zbtb11 G A 16: 56,006,871 R900H probably damaging Het
Zfp142 T C 1: 74,567,185 K1639R probably damaging Het
Other mutations in Sec24a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Sec24a APN 11 51736504 nonsense probably null
IGL00973:Sec24a APN 11 51729577 critical splice acceptor site probably null
IGL01364:Sec24a APN 11 51713529 critical splice donor site probably null
IGL01476:Sec24a APN 11 51708956 missense possibly damaging 0.88
IGL01725:Sec24a APN 11 51723578 splice site probably null
IGL02069:Sec24a APN 11 51733934 splice site probably benign
IGL02230:Sec24a APN 11 51709034 missense possibly damaging 0.88
IGL02617:Sec24a APN 11 51712187 critical splice donor site probably null
IGL02655:Sec24a APN 11 51734655 missense probably benign 0.43
IGL02756:Sec24a APN 11 51696733 missense probably benign 0.02
IGL03396:Sec24a APN 11 51708967 missense probably benign 0.17
R0153:Sec24a UTSW 11 51700826 missense probably benign 0.08
R0506:Sec24a UTSW 11 51743795 missense probably benign 0.03
R0625:Sec24a UTSW 11 51729454 missense probably damaging 0.98
R1084:Sec24a UTSW 11 51713581 missense probably damaging 1.00
R1166:Sec24a UTSW 11 51733467 missense possibly damaging 0.72
R1376:Sec24a UTSW 11 51700913 splice site probably benign
R1487:Sec24a UTSW 11 51731886 missense possibly damaging 0.92
R1541:Sec24a UTSW 11 51743796 missense probably benign 0.41
R1582:Sec24a UTSW 11 51708967 missense probably benign 0.17
R1643:Sec24a UTSW 11 51704385 missense probably benign 0.03
R1672:Sec24a UTSW 11 51743948 nonsense probably null
R1681:Sec24a UTSW 11 51695189 missense probably damaging 0.98
R1756:Sec24a UTSW 11 51733763 splice site probably benign
R1992:Sec24a UTSW 11 51736363 missense probably benign 0.00
R2159:Sec24a UTSW 11 51712350 missense probably damaging 1.00
R2177:Sec24a UTSW 11 51704401 missense probably benign 0.00
R2188:Sec24a UTSW 11 51723584 missense probably damaging 0.99
R2271:Sec24a UTSW 11 51716450 missense possibly damaging 0.91
R3414:Sec24a UTSW 11 51729458 missense probably damaging 1.00
R4349:Sec24a UTSW 11 51715149 missense probably benign 0.03
R4396:Sec24a UTSW 11 51715164 missense possibly damaging 0.86
R4629:Sec24a UTSW 11 51721813 critical splice donor site probably null
R5061:Sec24a UTSW 11 51713532 splice site probably null
R5577:Sec24a UTSW 11 51734621 missense probably benign 0.06
R5717:Sec24a UTSW 11 51707210 missense probably benign
R5915:Sec24a UTSW 11 51756137 missense probably benign 0.11
R6175:Sec24a UTSW 11 51731891 missense probably damaging 1.00
R6341:Sec24a UTSW 11 51717776 missense probably damaging 0.99
R6610:Sec24a UTSW 11 51696656 missense probably benign
R6632:Sec24a UTSW 11 51713649 nonsense probably null
R6907:Sec24a UTSW 11 51712276 missense probably damaging 1.00
R6969:Sec24a UTSW 11 51700816 missense probably benign 0.35
R7132:Sec24a UTSW 11 51715136 nonsense probably null
R7274:Sec24a UTSW 11 51707255 missense probably damaging 1.00
R7475:Sec24a UTSW 11 51713552 missense probably damaging 1.00
R7699:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7700:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7935:Sec24a UTSW 11 51721922 missense probably benign 0.25
R8042:Sec24a UTSW 11 51704317 missense probably benign
R8345:Sec24a UTSW 11 51743778 missense probably benign 0.00
X0025:Sec24a UTSW 11 51729547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCTGTACAAGTGCGTGCC -3'
(R):5'- TGTCTAAAAGGAGTGTGTTCTCTTC -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
(R):5'- TAAAAGGAGTGTGTTCTCTTCCAGGC -3'
Posted On2018-05-21