Incidental Mutation 'R6461:Grin2c'
ID 517609
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Name glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms NR2C, NMDAR2C, GluRepsilon3
MMRRC Submission 044390-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R6461 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115139995-115158069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115146522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 494 (M494K)
Ref Sequence ENSEMBL: ENSMUSP00000102164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]
AlphaFold Q01098
Predicted Effect possibly damaging
Transcript: ENSMUST00000003351
AA Change: M494K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: M494K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106554
AA Change: M494K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: M494K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158919
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb3 T A 10: 85,476,428 (GRCm39) I903N probably damaging Het
Atp12a C T 14: 56,610,695 (GRCm39) R280C probably damaging Het
Dnmbp A G 19: 43,855,964 (GRCm39) probably null Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fbxo40 T C 16: 36,790,390 (GRCm39) E240G probably benign Het
Gne T C 4: 44,060,078 (GRCm39) D105G probably damaging Het
Hnrnpk A G 13: 58,541,008 (GRCm39) probably null Het
Irf6 G C 1: 192,849,779 (GRCm39) G234R probably damaging Het
Lman2 A G 13: 55,494,728 (GRCm39) F347L probably damaging Het
Mcfd2 G A 17: 87,565,494 (GRCm39) T3I probably benign Het
Mon1b A G 8: 114,365,170 (GRCm39) D166G probably damaging Het
Mup10 T A 4: 60,538,078 (GRCm39) M4L unknown Het
Or13c7b T C 4: 43,821,355 (GRCm39) E2G probably benign Het
Or2h1b C T 17: 37,462,362 (GRCm39) C167Y probably damaging Het
Or51s1 T A 7: 102,558,235 (GRCm39) R270S possibly damaging Het
Papln A G 12: 83,828,587 (GRCm39) probably null Het
Pelp1 A T 11: 70,287,132 (GRCm39) V522E probably damaging Het
Scn1a T C 2: 66,156,466 (GRCm39) D481G probably null Het
Scube1 G A 15: 83,496,628 (GRCm39) T791I probably damaging Het
Sec24a T C 11: 51,604,373 (GRCm39) I748V possibly damaging Het
Slc29a2 A G 19: 5,077,768 (GRCm39) T236A probably benign Het
Smarca4 T A 9: 21,590,316 (GRCm39) I1152N probably damaging Het
Syngap1 A G 17: 27,183,822 (GRCm39) I1026V probably damaging Het
Tnxb G T 17: 34,890,872 (GRCm39) R405L probably damaging Het
Zbtb11 G A 16: 55,827,234 (GRCm39) R900H probably damaging Het
Zfp142 T C 1: 74,606,344 (GRCm39) K1639R probably damaging Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115,148,936 (GRCm39) missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115,147,020 (GRCm39) missense probably benign 0.01
IGL01408:Grin2c APN 11 115,151,708 (GRCm39) missense probably damaging 1.00
IGL01539:Grin2c APN 11 115,140,932 (GRCm39) missense probably benign 0.32
IGL01931:Grin2c APN 11 115,144,736 (GRCm39) missense probably damaging 1.00
IGL01964:Grin2c APN 11 115,144,673 (GRCm39) missense probably damaging 1.00
IGL02796:Grin2c APN 11 115,141,543 (GRCm39) splice site probably benign
IGL02956:Grin2c APN 11 115,148,785 (GRCm39) missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115,144,870 (GRCm39) splice site probably benign
ANU23:Grin2c UTSW 11 115,147,020 (GRCm39) missense probably benign 0.01
BB007:Grin2c UTSW 11 115,147,063 (GRCm39) missense probably benign 0.01
BB017:Grin2c UTSW 11 115,147,063 (GRCm39) missense probably benign 0.01
PIT4362001:Grin2c UTSW 11 115,140,459 (GRCm39) missense probably benign
R0011:Grin2c UTSW 11 115,146,576 (GRCm39) missense probably damaging 1.00
R0011:Grin2c UTSW 11 115,146,576 (GRCm39) missense probably damaging 1.00
R0112:Grin2c UTSW 11 115,141,960 (GRCm39) missense probably damaging 1.00
R0355:Grin2c UTSW 11 115,151,554 (GRCm39) splice site probably benign
R0681:Grin2c UTSW 11 115,140,479 (GRCm39) missense probably benign
R0791:Grin2c UTSW 11 115,141,472 (GRCm39) missense probably damaging 1.00
R0792:Grin2c UTSW 11 115,141,472 (GRCm39) missense probably damaging 1.00
R1512:Grin2c UTSW 11 115,144,676 (GRCm39) missense probably damaging 1.00
R1572:Grin2c UTSW 11 115,146,900 (GRCm39) missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115,151,679 (GRCm39) missense probably benign 0.21
R1803:Grin2c UTSW 11 115,151,558 (GRCm39) critical splice donor site probably null
R1982:Grin2c UTSW 11 115,151,731 (GRCm39) missense possibly damaging 0.96
R2050:Grin2c UTSW 11 115,148,245 (GRCm39) missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115,141,492 (GRCm39) missense probably benign 0.34
R2442:Grin2c UTSW 11 115,141,960 (GRCm39) missense probably damaging 1.00
R2509:Grin2c UTSW 11 115,141,894 (GRCm39) nonsense probably null
R3440:Grin2c UTSW 11 115,141,469 (GRCm39) missense probably damaging 1.00
R3965:Grin2c UTSW 11 115,151,820 (GRCm39) missense probably damaging 1.00
R4618:Grin2c UTSW 11 115,143,573 (GRCm39) missense probably damaging 1.00
R4735:Grin2c UTSW 11 115,140,422 (GRCm39) missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115,151,616 (GRCm39) missense probably damaging 1.00
R4886:Grin2c UTSW 11 115,151,616 (GRCm39) missense probably damaging 1.00
R5277:Grin2c UTSW 11 115,144,639 (GRCm39) missense probably damaging 1.00
R5334:Grin2c UTSW 11 115,146,881 (GRCm39) missense possibly damaging 0.76
R5553:Grin2c UTSW 11 115,143,551 (GRCm39) missense probably null 0.96
R5711:Grin2c UTSW 11 115,141,115 (GRCm39) missense probably benign 0.32
R5784:Grin2c UTSW 11 115,149,121 (GRCm39) missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115,151,817 (GRCm39) missense probably benign
R6421:Grin2c UTSW 11 115,141,956 (GRCm39) missense probably damaging 1.00
R6658:Grin2c UTSW 11 115,149,108 (GRCm39) missense possibly damaging 0.64
R7205:Grin2c UTSW 11 115,141,876 (GRCm39) missense probably damaging 0.99
R7611:Grin2c UTSW 11 115,143,511 (GRCm39) missense probably damaging 1.00
R7637:Grin2c UTSW 11 115,147,085 (GRCm39) splice site probably null
R7751:Grin2c UTSW 11 115,144,696 (GRCm39) missense probably damaging 1.00
R7847:Grin2c UTSW 11 115,151,804 (GRCm39) missense possibly damaging 0.68
R7920:Grin2c UTSW 11 115,144,970 (GRCm39) missense probably benign 0.33
R7930:Grin2c UTSW 11 115,147,063 (GRCm39) missense probably benign 0.01
R7940:Grin2c UTSW 11 115,146,107 (GRCm39) missense probably damaging 1.00
R7956:Grin2c UTSW 11 115,140,974 (GRCm39) missense probably benign 0.16
R8081:Grin2c UTSW 11 115,140,719 (GRCm39) missense probably damaging 0.98
R8249:Grin2c UTSW 11 115,144,663 (GRCm39) missense probably damaging 0.98
R8447:Grin2c UTSW 11 115,148,215 (GRCm39) missense probably benign 0.01
R9034:Grin2c UTSW 11 115,142,065 (GRCm39) missense probably damaging 1.00
R9409:Grin2c UTSW 11 115,144,106 (GRCm39) missense probably benign 0.06
R9432:Grin2c UTSW 11 115,142,052 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTGGAATCGGCTACTCC -3'
(R):5'- TTCATATGCCAGGCTGGGAG -3'

Sequencing Primer
(F):5'- GGAATCGGCTACTCCCTCCC -3'
(R):5'- GACTTTGAAGGGCTCTGACTCC -3'
Posted On 2018-05-21