Incidental Mutation 'R6461:Enpp5'
ID517619
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 5
SynonymsD17Abb1e
MMRRC Submission 044390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6461 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location44078813-44086567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44085264 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 356 (G356S)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
Predicted Effect probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.9168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp12a C T 14: 56,373,238 R280C probably damaging Het
Btbd11 T A 10: 85,640,564 I903N probably damaging Het
Dnmbp A G 19: 43,867,525 probably null Het
Fbxo40 T C 16: 36,970,028 E240G probably benign Het
Gne T C 4: 44,060,078 D105G probably damaging Het
Grin2c A T 11: 115,255,696 M494K possibly damaging Het
Hnrnpk A G 13: 58,393,194 probably null Het
Irf6 G C 1: 193,167,471 G234R probably damaging Het
Lman2 A G 13: 55,346,915 F347L probably damaging Het
Mcfd2 G A 17: 87,258,066 T3I probably benign Het
Mon1b A G 8: 113,638,538 D166G probably damaging Het
Mup10 T A 4: 60,582,079 M4L unknown Het
Olfr156 T C 4: 43,821,355 E2G probably benign Het
Olfr571 T A 7: 102,909,028 R270S possibly damaging Het
Olfr93 C T 17: 37,151,471 C167Y probably damaging Het
Papln A G 12: 83,781,813 probably null Het
Pelp1 A T 11: 70,396,306 V522E probably damaging Het
Scn1a T C 2: 66,326,122 D481G probably null Het
Scube1 G A 15: 83,612,427 T791I probably damaging Het
Sec24a T C 11: 51,713,546 I748V possibly damaging Het
Slc29a2 A G 19: 5,027,740 T236A probably benign Het
Smarca4 T A 9: 21,679,020 I1152N probably damaging Het
Syngap1 A G 17: 26,964,848 I1026V probably damaging Het
Tnxb G T 17: 34,671,898 R405L probably damaging Het
Zbtb11 G A 16: 56,006,871 R900H probably damaging Het
Zfp142 T C 1: 74,567,185 K1639R probably damaging Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6463:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R8211:Enpp5 UTSW 17 44081511 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- ACTCTGTGTGTAAGGAATTGGC -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTTGGGAGTTGCTGAACTGAGAAG -3'
Posted On2018-05-21