Incidental Mutation 'R6461:Slc29a2'
ID517621
Institutional Source Beutler Lab
Gene Symbol Slc29a2
Ensembl Gene ENSMUSG00000024891
Gene Namesolute carrier family 29 (nucleoside transporters), member 2
SynonymsHNP36, ENT2, Der12
MMRRC Submission 044390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6461 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5024006-5031971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5027740 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000025826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025826]
Predicted Effect probably benign
Transcript: ENSMUST00000025826
AA Change: T236A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025826
Gene: ENSMUSG00000024891
AA Change: T236A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Nucleoside_tran 130 454 3.7e-117 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The uptake of nucleosides by transporters, such as SLC29A2, is essential for nucleotide synthesis by salvage pathways in cells that lack de novo biosynthetic pathways. Nucleoside transport also plays a key role in the regulation of many physiologic processes through its effect on adenosine concentration at the cell surface (Griffiths et al., 1997 [PubMed 9396714]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal adenosine uptake in erythrocytes and protection from acute lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp12a C T 14: 56,373,238 R280C probably damaging Het
Btbd11 T A 10: 85,640,564 I903N probably damaging Het
Dnmbp A G 19: 43,867,525 probably null Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fbxo40 T C 16: 36,970,028 E240G probably benign Het
Gne T C 4: 44,060,078 D105G probably damaging Het
Grin2c A T 11: 115,255,696 M494K possibly damaging Het
Hnrnpk A G 13: 58,393,194 probably null Het
Irf6 G C 1: 193,167,471 G234R probably damaging Het
Lman2 A G 13: 55,346,915 F347L probably damaging Het
Mcfd2 G A 17: 87,258,066 T3I probably benign Het
Mon1b A G 8: 113,638,538 D166G probably damaging Het
Mup10 T A 4: 60,582,079 M4L unknown Het
Olfr156 T C 4: 43,821,355 E2G probably benign Het
Olfr571 T A 7: 102,909,028 R270S possibly damaging Het
Olfr93 C T 17: 37,151,471 C167Y probably damaging Het
Papln A G 12: 83,781,813 probably null Het
Pelp1 A T 11: 70,396,306 V522E probably damaging Het
Scn1a T C 2: 66,326,122 D481G probably null Het
Scube1 G A 15: 83,612,427 T791I probably damaging Het
Sec24a T C 11: 51,713,546 I748V possibly damaging Het
Smarca4 T A 9: 21,679,020 I1152N probably damaging Het
Syngap1 A G 17: 26,964,848 I1026V probably damaging Het
Tnxb G T 17: 34,671,898 R405L probably damaging Het
Zbtb11 G A 16: 56,006,871 R900H probably damaging Het
Zfp142 T C 1: 74,567,185 K1639R probably damaging Het
Other mutations in Slc29a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Slc29a2 APN 19 5027439 missense possibly damaging 0.72
IGL01727:Slc29a2 APN 19 5026458 missense probably damaging 0.98
IGL03268:Slc29a2 APN 19 5024503 splice site probably benign
R4050:Slc29a2 UTSW 19 5029453 missense possibly damaging 0.92
R4615:Slc29a2 UTSW 19 5029264 missense probably damaging 0.98
R5186:Slc29a2 UTSW 19 5028967 missense probably benign 0.00
R5450:Slc29a2 UTSW 19 5029275 missense probably benign 0.24
R5512:Slc29a2 UTSW 19 5026398 missense probably benign 0.03
R6809:Slc29a2 UTSW 19 5029243 missense probably damaging 1.00
R7447:Slc29a2 UTSW 19 5026417 missense probably damaging 1.00
R7671:Slc29a2 UTSW 19 5024262 missense probably benign 0.15
R8427:Slc29a2 UTSW 19 5030420 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATCTGGTAAGCCTGCCACAG -3'
(R):5'- GCTCGTGGATCCAAAATGCTC -3'

Sequencing Primer
(F):5'- CACAGGGCTTAGGTTATGCAC -3'
(R):5'- TTGTTCAAGAGGAAACTGAACCAC -3'
Posted On2018-05-21