Incidental Mutation 'R6461:Dnmbp'
ID517622
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Namedynamin binding protein
Synonyms2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission 044390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6461 (G1)
Quality Score161.009
Status Not validated
Chromosome19
Chromosomal Location43846821-43940191 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 43867525 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
Predicted Effect probably null
Transcript: ENSMUST00000026209
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000212032
Predicted Effect probably null
Transcript: ENSMUST00000212048
Predicted Effect probably null
Transcript: ENSMUST00000212396
Predicted Effect probably null
Transcript: ENSMUST00000212592
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp12a C T 14: 56,373,238 R280C probably damaging Het
Btbd11 T A 10: 85,640,564 I903N probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fbxo40 T C 16: 36,970,028 E240G probably benign Het
Gne T C 4: 44,060,078 D105G probably damaging Het
Grin2c A T 11: 115,255,696 M494K possibly damaging Het
Hnrnpk A G 13: 58,393,194 probably null Het
Irf6 G C 1: 193,167,471 G234R probably damaging Het
Lman2 A G 13: 55,346,915 F347L probably damaging Het
Mcfd2 G A 17: 87,258,066 T3I probably benign Het
Mon1b A G 8: 113,638,538 D166G probably damaging Het
Mup10 T A 4: 60,582,079 M4L unknown Het
Olfr156 T C 4: 43,821,355 E2G probably benign Het
Olfr571 T A 7: 102,909,028 R270S possibly damaging Het
Olfr93 C T 17: 37,151,471 C167Y probably damaging Het
Papln A G 12: 83,781,813 probably null Het
Pelp1 A T 11: 70,396,306 V522E probably damaging Het
Scn1a T C 2: 66,326,122 D481G probably null Het
Scube1 G A 15: 83,612,427 T791I probably damaging Het
Sec24a T C 11: 51,713,546 I748V possibly damaging Het
Slc29a2 A G 19: 5,027,740 T236A probably benign Het
Smarca4 T A 9: 21,679,020 I1152N probably damaging Het
Syngap1 A G 17: 26,964,848 I1026V probably damaging Het
Tnxb G T 17: 34,671,898 R405L probably damaging Het
Zbtb11 G A 16: 56,006,871 R900H probably damaging Het
Zfp142 T C 1: 74,567,185 K1639R probably damaging Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCCTCTGTGCAGATTATACGC -3'
(R):5'- GATTTAGAGAAGCCTCGCGTC -3'

Sequencing Primer
(F):5'- GCAGATTATACGCAGCTTGG -3'
(R):5'- AGAAGCCTCGCGTCTCTGG -3'
Posted On2018-05-21