Incidental Mutation 'R6462:Brd9'
ID517648
Institutional Source Beutler Lab
Gene Symbol Brd9
Ensembl Gene ENSMUSG00000057649
Gene Namebromodomain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6462 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73937811-73960895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73940669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 171 (A171V)
Ref Sequence ENSEMBL: ENSMUSP00000152257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022053] [ENSMUST00000099384] [ENSMUST00000222399] [ENSMUST00000222749] [ENSMUST00000223238]
Predicted Effect probably benign
Transcript: ENSMUST00000022053
SMART Domains Protein: ENSMUSP00000022053
Gene: ENSMUSG00000021569

DomainStartEndE-ValueType
AAA 171 323 1.13e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099384
AA Change: A162V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096982
Gene: ENSMUSG00000057649
AA Change: A162V

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
coiled coil region 53 104 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
BROMO 134 242 1.52e-30 SMART
low complexity region 249 264 N/A INTRINSIC
Pfam:DUF3512 274 505 1.6e-82 PFAM
low complexity region 544 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222191
Predicted Effect probably damaging
Transcript: ENSMUST00000222399
AA Change: A162V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000222749
AA Change: A171V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000223017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223063
Predicted Effect probably benign
Transcript: ENSMUST00000223238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223455
Predicted Effect unknown
Transcript: ENSMUST00000223525
AA Change: A76V
Meta Mutation Damage Score 0.2694 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc1a C T 5: 145,108,387 S362F probably benign Het
Camta1 A G 4: 151,086,164 V62A probably damaging Het
Cdc5l G A 17: 45,393,049 R750C probably benign Het
Ctdp1 C T 18: 80,420,474 E116K probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epor T C 9: 21,959,255 E443G probably benign Het
Fam90a1a A T 8: 21,959,282 Q14L probably benign Het
Herc4 T C 10: 63,289,101 L498P probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lmod2 T G 6: 24,604,301 V425G probably benign Het
Ly6c1 T A 15: 75,044,329 probably benign Het
Me2 C A 18: 73,775,399 V490F probably benign Het
Mllt3 T C 4: 87,774,101 T27A probably damaging Het
Mmp1a T C 9: 7,467,038 Y239H probably benign Het
Mycbp2 A G 14: 103,136,557 probably null Het
Myo15b A C 11: 115,859,442 E346A probably benign Het
Myo3a T C 2: 22,558,411 F66S probably damaging Het
Ncor2 T C 5: 125,024,172 Y137C probably damaging Het
Nup98 A T 7: 102,195,016 F37L probably benign Het
Odf2l T G 3: 145,146,911 L472R probably damaging Het
Olfr118 T C 17: 37,672,220 Y66H probably damaging Het
P4ha3 T A 7: 100,314,666 I463N probably damaging Het
Pappa C A 4: 65,124,891 T117K probably damaging Het
Ppme1 C A 7: 100,338,392 R271M probably benign Het
Rps6ka4 T G 19: 6,837,589 E249A possibly damaging Het
Rxfp1 T A 3: 79,648,289 I587F probably benign Het
Sipa1l2 A G 8: 125,491,230 V456A probably damaging Het
Slc25a23 T A 17: 57,052,720 I344F probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tbc1d10c T C 19: 4,184,894 I389M possibly damaging Het
Tep1 A G 14: 50,844,379 F1205L probably benign Het
Tgfbr1 T A 4: 47,402,846 H214Q probably damaging Het
Traf3ip2 T A 10: 39,639,247 N340K probably benign Het
Wdr60 T C 12: 116,229,631 N567S probably benign Het
Zbbx T C 3: 75,078,659 E362G probably benign Het
Zfp46 A C 4: 136,290,613 T253P probably damaging Het
Other mutations in Brd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Brd9 APN 13 73938547 missense probably damaging 0.98
IGL01461:Brd9 APN 13 73951598 nonsense probably null
IGL01928:Brd9 APN 13 73955511 missense probably benign 0.02
R0379:Brd9 UTSW 13 73942683 splice site probably benign
R0420:Brd9 UTSW 13 73955473 missense probably benign
R0788:Brd9 UTSW 13 73944867 splice site probably benign
R1539:Brd9 UTSW 13 73944743 missense probably damaging 0.99
R4095:Brd9 UTSW 13 73944799 missense probably benign 0.19
R4582:Brd9 UTSW 13 73947733 missense probably benign 0.00
R4648:Brd9 UTSW 13 73940776 missense probably benign 0.37
R4915:Brd9 UTSW 13 73938455 missense probably damaging 0.99
R6054:Brd9 UTSW 13 73940741 missense probably damaging 1.00
R6175:Brd9 UTSW 13 73960314 missense probably damaging 0.98
R6520:Brd9 UTSW 13 73942794 missense probably benign 0.00
R7217:Brd9 UTSW 13 73938944 missense probably damaging 1.00
R7360:Brd9 UTSW 13 73944823 missense probably benign 0.07
R7422:Brd9 UTSW 13 73954578 missense probably benign
R7556:Brd9 UTSW 13 73944767 missense possibly damaging 0.83
R7844:Brd9 UTSW 13 73938533 missense probably damaging 1.00
Z1176:Brd9 UTSW 13 73944751 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTTGTGCTGCCTCCAG -3'
(R):5'- ATGCATGCACCCACAGTTTTAC -3'

Sequencing Primer
(F):5'- CACTGCCTGTCATGGGTAGAG -3'
(R):5'- TGCACCCACAGTTTTACAAACATTG -3'
Posted On2018-05-21