Incidental Mutation 'R6462:Ly6c1'
ID517652
Institutional Source Beutler Lab
Gene Symbol Ly6c1
Ensembl Gene ENSMUSG00000079018
Gene Namelymphocyte antigen 6 complex, locus C1
SynonymsLy-6C, Ly6c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6462 (G1)
Quality Score210.009
Status Validated
Chromosome15
Chromosomal Location75044018-75048830 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 75044329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065408] [ENSMUST00000179762] [ENSMUST00000185200] [ENSMUST00000185372] [ENSMUST00000187347] [ENSMUST00000188845] [ENSMUST00000191216]
Predicted Effect probably benign
Transcript: ENSMUST00000065408
SMART Domains Protein: ENSMUSP00000066954
Gene: ENSMUSG00000079018

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 115 1.62e-32 SMART
low complexity region 117 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179762
SMART Domains Protein: ENSMUSP00000137401
Gene: ENSMUSG00000079018

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 115 1.62e-32 SMART
low complexity region 117 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185200
SMART Domains Protein: ENSMUSP00000140622
Gene: ENSMUSG00000079018

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPAR_LY6 29 77 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185372
SMART Domains Protein: ENSMUSP00000139948
Gene: ENSMUSG00000079018

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPAR_LY6 29 77 6.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187347
SMART Domains Protein: ENSMUSP00000139799
Gene: ENSMUSG00000079018

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 115 1.62e-32 SMART
low complexity region 117 131 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000188845
AA Change: L147F
SMART Domains Protein: ENSMUSP00000139559
Gene: ENSMUSG00000079018
AA Change: L147F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 115 1.52e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191216
SMART Domains Protein: ENSMUSP00000140722
Gene: ENSMUSG00000079018

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 111 5.2e-27 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc1a C T 5: 145,108,387 S362F probably benign Het
Brd9 C T 13: 73,940,669 A171V probably damaging Het
Camta1 A G 4: 151,086,164 V62A probably damaging Het
Cdc5l G A 17: 45,393,049 R750C probably benign Het
Ctdp1 C T 18: 80,420,474 E116K probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epor T C 9: 21,959,255 E443G probably benign Het
Fam90a1a A T 8: 21,959,282 Q14L probably benign Het
Herc4 T C 10: 63,289,101 L498P probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lmod2 T G 6: 24,604,301 V425G probably benign Het
Me2 C A 18: 73,775,399 V490F probably benign Het
Mllt3 T C 4: 87,774,101 T27A probably damaging Het
Mmp1a T C 9: 7,467,038 Y239H probably benign Het
Mycbp2 A G 14: 103,136,557 probably null Het
Myo15b A C 11: 115,859,442 E346A probably benign Het
Myo3a T C 2: 22,558,411 F66S probably damaging Het
Ncor2 T C 5: 125,024,172 Y137C probably damaging Het
Nup98 A T 7: 102,195,016 F37L probably benign Het
Odf2l T G 3: 145,146,911 L472R probably damaging Het
Olfr118 T C 17: 37,672,220 Y66H probably damaging Het
P4ha3 T A 7: 100,314,666 I463N probably damaging Het
Pappa C A 4: 65,124,891 T117K probably damaging Het
Ppme1 C A 7: 100,338,392 R271M probably benign Het
Rps6ka4 T G 19: 6,837,589 E249A possibly damaging Het
Rxfp1 T A 3: 79,648,289 I587F probably benign Het
Sipa1l2 A G 8: 125,491,230 V456A probably damaging Het
Slc25a23 T A 17: 57,052,720 I344F probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tbc1d10c T C 19: 4,184,894 I389M possibly damaging Het
Tep1 A G 14: 50,844,379 F1205L probably benign Het
Tgfbr1 T A 4: 47,402,846 H214Q probably damaging Het
Traf3ip2 T A 10: 39,639,247 N340K probably benign Het
Wdr60 T C 12: 116,229,631 N567S probably benign Het
Zbbx T C 3: 75,078,659 E362G probably benign Het
Zfp46 A C 4: 136,290,613 T253P probably damaging Het
Other mutations in Ly6c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2002:Ly6c1 UTSW 15 75048493 missense possibly damaging 0.62
R3881:Ly6c1 UTSW 15 75045587 missense probably benign 0.07
R5986:Ly6c1 UTSW 15 75045608 missense probably damaging 1.00
R6966:Ly6c1 UTSW 15 75045440 unclassified probably benign
R7169:Ly6c1 UTSW 15 75044646 missense probably benign 0.00
R7355:Ly6c1 UTSW 15 75047407 missense possibly damaging 0.78
R7583:Ly6c1 UTSW 15 75048497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCCTTGGGGTTACAAC -3'
(R):5'- GCCCAGAAGTGAAAACCATTTC -3'

Sequencing Primer
(F):5'- TGATCGACTCAGCTCCATGAG -3'
(R):5'- ATTTCCTGGCTTTTGGCTTAC -3'
Posted On2018-05-21