Incidental Mutation 'R6462:Olfr118'
ID517653
Institutional Source Beutler Lab
Gene Symbol Olfr118
Ensembl Gene ENSMUSG00000080990
Gene Nameolfactory receptor 118
SynonymsMOR263-13, GA_x6K02T2PSCP-2131124-2132089
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6462 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37666988-37673476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37672220 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 66 (Y66H)
Ref Sequence ENSEMBL: ENSMUSP00000151212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
Predicted Effect probably damaging
Transcript: ENSMUST00000122036
AA Change: Y66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: Y66H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215811
AA Change: Y66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216551
AA Change: Y66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc1a C T 5: 145,108,387 S362F probably benign Het
Brd9 C T 13: 73,940,669 A171V probably damaging Het
Camta1 A G 4: 151,086,164 V62A probably damaging Het
Cdc5l G A 17: 45,393,049 R750C probably benign Het
Ctdp1 C T 18: 80,420,474 E116K probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epor T C 9: 21,959,255 E443G probably benign Het
Fam90a1a A T 8: 21,959,282 Q14L probably benign Het
Herc4 T C 10: 63,289,101 L498P probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lmod2 T G 6: 24,604,301 V425G probably benign Het
Ly6c1 T A 15: 75,044,329 probably benign Het
Me2 C A 18: 73,775,399 V490F probably benign Het
Mllt3 T C 4: 87,774,101 T27A probably damaging Het
Mmp1a T C 9: 7,467,038 Y239H probably benign Het
Mycbp2 A G 14: 103,136,557 probably null Het
Myo15b A C 11: 115,859,442 E346A probably benign Het
Myo3a T C 2: 22,558,411 F66S probably damaging Het
Ncor2 T C 5: 125,024,172 Y137C probably damaging Het
Nup98 A T 7: 102,195,016 F37L probably benign Het
Odf2l T G 3: 145,146,911 L472R probably damaging Het
P4ha3 T A 7: 100,314,666 I463N probably damaging Het
Pappa C A 4: 65,124,891 T117K probably damaging Het
Ppme1 C A 7: 100,338,392 R271M probably benign Het
Rps6ka4 T G 19: 6,837,589 E249A possibly damaging Het
Rxfp1 T A 3: 79,648,289 I587F probably benign Het
Sipa1l2 A G 8: 125,491,230 V456A probably damaging Het
Slc25a23 T A 17: 57,052,720 I344F probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tbc1d10c T C 19: 4,184,894 I389M possibly damaging Het
Tep1 A G 14: 50,844,379 F1205L probably benign Het
Tgfbr1 T A 4: 47,402,846 H214Q probably damaging Het
Traf3ip2 T A 10: 39,639,247 N340K probably benign Het
Wdr60 T C 12: 116,229,631 N567S probably benign Het
Zbbx T C 3: 75,078,659 E362G probably benign Het
Zfp46 A C 4: 136,290,613 T253P probably damaging Het
Other mutations in Olfr118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Olfr118 APN 17 37672887 missense probably damaging 1.00
IGL02456:Olfr118 APN 17 37672449 missense possibly damaging 0.90
IGL02750:Olfr118 APN 17 37672609 nonsense probably null
IGL03083:Olfr118 APN 17 37672660 nonsense probably null
IGL03339:Olfr118 APN 17 37672557 missense possibly damaging 0.87
R0032:Olfr118 UTSW 17 37672487 missense probably damaging 1.00
R1457:Olfr118 UTSW 17 37672925 nonsense probably null
R1542:Olfr118 UTSW 17 37672251 missense probably damaging 1.00
R1771:Olfr118 UTSW 17 37672663 missense probably damaging 1.00
R1893:Olfr118 UTSW 17 37672856 nonsense probably null
R2395:Olfr118 UTSW 17 37672696 nonsense probably null
R3619:Olfr118 UTSW 17 37672640 missense probably benign 0.05
R3917:Olfr118 UTSW 17 37672793 missense probably damaging 1.00
R3937:Olfr118 UTSW 17 37672967 missense probably benign 0.01
R5600:Olfr118 UTSW 17 37672285 missense possibly damaging 0.91
R6415:Olfr118 UTSW 17 37672557 missense possibly damaging 0.87
R7355:Olfr118 UTSW 17 37672410 missense probably benign 0.02
R7861:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7913:Olfr118 UTSW 17 37672108 missense probably benign
R7952:Olfr118 UTSW 17 37672817 missense probably damaging 1.00
R7969:Olfr118 UTSW 17 37672656 missense probably damaging 1.00
RF003:Olfr118 UTSW 17 37672858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCAACTGCTCTCTGTGG -3'
(R):5'- GGGAGCATATGGCCATGTAG -3'

Sequencing Primer
(F):5'- TGCTCTCTGTGGCAGGAGAAC -3'
(R):5'- AGCATATGGCCATGTAGCGGTC -3'
Posted On2018-05-21