Incidental Mutation 'R6462:Cdc5l'
ID517655
Institutional Source Beutler Lab
Gene Symbol Cdc5l
Ensembl Gene ENSMUSG00000023932
Gene Namecell division cycle 5-like (S. pombe)
SynonymsPCDC5RP, 1200002I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6462 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45391892-45433707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45393049 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 750 (R750C)
Ref Sequence ENSEMBL: ENSMUSP00000024727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024727]
Predicted Effect probably benign
Transcript: ENSMUST00000024727
AA Change: R750C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024727
Gene: ENSMUSG00000023932
AA Change: R750C

DomainStartEndE-ValueType
SANT 7 56 4.41e-15 SMART
SANT 59 106 6.29e-11 SMART
coiled coil region 150 181 N/A INTRINSIC
Blast:SANT 187 233 5e-23 BLAST
low complexity region 258 271 N/A INTRINSIC
Pfam:Myb_Cef 404 655 3.1e-85 PFAM
low complexity region 706 718 N/A INTRINSIC
coiled coil region 764 802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares a significant similarity with Schizosaccharomyces pombe cdc5 gene product, which is a cell cycle regulator important for G2/M transition. This protein has been demonstrated to act as a positive regulator of cell cycle G2/M progression. It was also found to be an essential component of a non-snRNA spliceosome, which contains at least five additional protein factors and is required for the second catalytic step of pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpc1a C T 5: 145,108,387 S362F probably benign Het
Brd9 C T 13: 73,940,669 A171V probably damaging Het
Camta1 A G 4: 151,086,164 V62A probably damaging Het
Ctdp1 C T 18: 80,420,474 E116K probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epor T C 9: 21,959,255 E443G probably benign Het
Fam90a1a A T 8: 21,959,282 Q14L probably benign Het
Herc4 T C 10: 63,289,101 L498P probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lmod2 T G 6: 24,604,301 V425G probably benign Het
Ly6c1 T A 15: 75,044,329 probably benign Het
Me2 C A 18: 73,775,399 V490F probably benign Het
Mllt3 T C 4: 87,774,101 T27A probably damaging Het
Mmp1a T C 9: 7,467,038 Y239H probably benign Het
Mycbp2 A G 14: 103,136,557 probably null Het
Myo15b A C 11: 115,859,442 E346A probably benign Het
Myo3a T C 2: 22,558,411 F66S probably damaging Het
Ncor2 T C 5: 125,024,172 Y137C probably damaging Het
Nup98 A T 7: 102,195,016 F37L probably benign Het
Odf2l T G 3: 145,146,911 L472R probably damaging Het
Olfr118 T C 17: 37,672,220 Y66H probably damaging Het
P4ha3 T A 7: 100,314,666 I463N probably damaging Het
Pappa C A 4: 65,124,891 T117K probably damaging Het
Ppme1 C A 7: 100,338,392 R271M probably benign Het
Rps6ka4 T G 19: 6,837,589 E249A possibly damaging Het
Rxfp1 T A 3: 79,648,289 I587F probably benign Het
Sipa1l2 A G 8: 125,491,230 V456A probably damaging Het
Slc25a23 T A 17: 57,052,720 I344F probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tbc1d10c T C 19: 4,184,894 I389M possibly damaging Het
Tep1 A G 14: 50,844,379 F1205L probably benign Het
Tgfbr1 T A 4: 47,402,846 H214Q probably damaging Het
Traf3ip2 T A 10: 39,639,247 N340K probably benign Het
Wdr60 T C 12: 116,229,631 N567S probably benign Het
Zbbx T C 3: 75,078,659 E362G probably benign Het
Zfp46 A C 4: 136,290,613 T253P probably damaging Het
Other mutations in Cdc5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Cdc5l APN 17 45404676 missense probably damaging 0.98
IGL01629:Cdc5l APN 17 45413190 missense probably benign 0.26
IGL02596:Cdc5l APN 17 45424604 splice site probably benign
IGL02973:Cdc5l APN 17 45404647 missense probably benign 0.31
IGL03102:Cdc5l APN 17 45407931 missense probably damaging 0.99
IGL03113:Cdc5l APN 17 45433422 missense possibly damaging 0.47
R0255:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0333:Cdc5l UTSW 17 45393216 splice site probably benign
R0432:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0532:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0551:Cdc5l UTSW 17 45415684 missense probably damaging 1.00
R0839:Cdc5l UTSW 17 45393147 missense probably benign 0.10
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1462:Cdc5l UTSW 17 45408362 missense possibly damaging 0.77
R1483:Cdc5l UTSW 17 45408364 missense possibly damaging 0.79
R1634:Cdc5l UTSW 17 45404706 missense probably damaging 0.99
R1751:Cdc5l UTSW 17 45407805 missense probably benign
R1954:Cdc5l UTSW 17 45426516 splice site probably null
R1955:Cdc5l UTSW 17 45426516 splice site probably null
R2197:Cdc5l UTSW 17 45407819 missense probably benign 0.00
R2229:Cdc5l UTSW 17 45407846 missense probably benign 0.04
R4060:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4061:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4064:Cdc5l UTSW 17 45410890 missense probably benign 0.00
R4172:Cdc5l UTSW 17 45419772 missense probably damaging 1.00
R4334:Cdc5l UTSW 17 45410786 missense probably benign 0.00
R5093:Cdc5l UTSW 17 45393041 missense possibly damaging 0.50
R5268:Cdc5l UTSW 17 45415585 missense probably damaging 0.99
R5729:Cdc5l UTSW 17 45426569 missense probably benign 0.39
R6190:Cdc5l UTSW 17 45408017 missense probably benign 0.08
R6540:Cdc5l UTSW 17 45426644 missense probably damaging 1.00
R7232:Cdc5l UTSW 17 45427937 critical splice donor site probably null
R7381:Cdc5l UTSW 17 45411923 missense probably benign 0.00
R7589:Cdc5l UTSW 17 45410781 missense probably benign 0.41
R8120:Cdc5l UTSW 17 45407870 missense probably benign 0.00
R8424:Cdc5l UTSW 17 45415600 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGCCATCTAAGCATAGCCAGG -3'
(R):5'- AGAGGAACCTGGTGTATTTTGC -3'

Sequencing Primer
(F):5'- TCTAAGCATAGCCAGGTCTAGATCAG -3'
(R):5'- TGCTTTAGGTACTTAGTTTAGCCC -3'
Posted On2018-05-21