Mutagenetix > Incidental Mutation

Incidental Mutation 'R6463:Ttll7'

517672

Institutional Source

Beutler Lab

Gene Symbol

Ttll7

Ensembl Gene

ENSMUSG00000036745

Gene Name

tubulin tyrosine ligase-like family, member 7

Synonyms

1110049N09Rik, 4921517B04Rik

MMRRC Submission

045324-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.352) question?

Stock #

R6463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146852367-146984009 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 146931582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 490 (R490Q)

Ref Sequence

ENSEMBL: ENSMUSP00000043753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037942
AA Change: R490Q

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000038090

SMART Domains

Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	9e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC
low complexity region	591	601	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106134
AA Change: R490Q

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: R490Q

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	7.2e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170055
AA Change: R490Q

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: R490Q

Domain	Start	End	E-Value	Type
low complexity region	29	38	N/A	INTRINSIC
Pfam:TTL	84	388	5.9e-80	PFAM
low complexity region	417	439	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
low complexity region	549	563	N/A	INTRINSIC

Meta Mutation Damage Score

0.0963

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,938	H48L	probably damaging	Het
Aifm3	A	G	16: 17,500,789	I185V	probably benign	Het
Asb7	A	T	7: 66,660,236	D77E	probably damaging	Het
Cacna1i	T	C	15: 80,355,758	I336T	probably damaging	Het
Cadps2	A	T	6: 23,323,334	L1016*	probably null	Het
Ccdc129	A	G	6: 55,968,678	R795G	probably benign	Het
Cep63	C	A	9: 102,596,155	M504I	probably benign	Het
Chpf2	G	T	5: 24,589,526	L231F	probably damaging	Het
Cnot10	T	C	9: 114,625,902	Y221C	probably damaging	Het
Col3a1	G	A	1: 45,342,205		probably benign	Het
Csl	T	C	10: 99,759,098	D35G	probably damaging	Het
Csmd3	T	C	15: 47,676,479	Y2286C	probably damaging	Het
Dbt	A	G	3: 116,539,760	E293G	possibly damaging	Het
Ddx31	T	A	2: 28,847,513		probably null	Het
Dnm1	T	C	2: 32,309,591		probably benign	Het
Elfn1	A	G	5: 139,972,285	Y348C	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha5	T	A	5: 84,106,710	I657F	probably damaging	Het
Fbp1	A	G	13: 62,865,010	F123S	possibly damaging	Het
Hkdc1	T	C	10: 62,393,702	N732S	probably damaging	Het
Itfg1	A	G	8: 85,736,151	S448P	probably benign	Het
Izumo2	A	G	7: 44,709,074	K84R	probably benign	Het
Kbtbd3	A	G	9: 4,316,921	Y24C	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Mdn1	T	C	4: 32,773,308	L5489P	probably damaging	Het
Mettl2	G	A	11: 105,132,581		probably null	Het
Mtr	T	C	13: 12,216,866	T651A	probably benign	Het
Naglu	A	G	11: 101,077,351		probably null	Het
Nkx6-1	G	T	5: 101,659,476	H347N	probably damaging	Het
Ntpcr	A	G	8: 125,736,104	E20G	probably benign	Het
Oas2	T	C	5: 120,734,981	R670G	probably null	Het
Olfr1208	T	C	2: 88,897,118	I160V	probably benign	Het
Olfr239	G	A	17: 33,199,638	V197I	probably benign	Het
Olfr698	C	G	7: 106,752,801	E196Q	probably benign	Het
Phldb2	A	C	16: 45,774,993	V902G	probably benign	Het
Rdh7	T	C	10: 127,885,781	R209G	probably benign	Het
Slc13a3	A	C	2: 165,445,653	L127R	probably damaging	Het
Slc6a20b	T	A	9: 123,604,949	I275F	possibly damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tmx4	T	C	2: 134,620,639	Y124C	probably damaging	Het
Trh	A	T	6: 92,242,843	M164K	possibly damaging	Het
Trhr	A	G	15: 44,197,585	N167S	probably benign	Het
Uck1	T	C	2: 32,258,655	N100S	probably benign	Het
Ucp3	A	T	7: 100,480,269	T104S	probably benign	Het
Vmn2r28	T	A	7: 5,486,436	H468L	probably benign	Het
Xaf1	G	A	11: 72,308,638	R67H	probably benign	Het
Ypel4	T	C	2: 84,736,743		probably benign	Het
Zfp687	A	G	3: 95,010,784	I559T	probably damaging	Het

Other mutations in Ttll7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ttll7	APN	3	146909582	missense	possibly damaging	0.72
IGL01353:Ttll7	APN	3	146961719	missense	probably damaging	1.00
IGL01415:Ttll7	APN	3	146909599	missense	possibly damaging	0.90
IGL01843:Ttll7	APN	3	146940021	missense	possibly damaging	0.93
IGL03101:Ttll7	APN	3	146896690	missense	possibly damaging	0.82
IGL03378:Ttll7	APN	3	146909653	missense	probably benign	0.06
P0038:Ttll7	UTSW	3	146945184	missense	possibly damaging	0.80
R0265:Ttll7	UTSW	3	146944160	nonsense	probably null
R0358:Ttll7	UTSW	3	146944116	missense	probably benign
R0363:Ttll7	UTSW	3	146944215	missense	probably benign	0.00
R0364:Ttll7	UTSW	3	146945181	missense	possibly damaging	0.82
R0751:Ttll7	UTSW	3	146939991	missense	probably damaging	1.00
R1184:Ttll7	UTSW	3	146939991	missense	probably damaging	1.00
R1533:Ttll7	UTSW	3	146896667	missense	probably damaging	1.00
R1771:Ttll7	UTSW	3	146894405	missense	probably benign	0.02
R1789:Ttll7	UTSW	3	146915780	missense	probably damaging	1.00
R1961:Ttll7	UTSW	3	146915795	splice site	probably benign
R1995:Ttll7	UTSW	3	146961755	missense	possibly damaging	0.95
R2083:Ttll7	UTSW	3	146930104	missense	possibly damaging	0.77
R2152:Ttll7	UTSW	3	146930189	missense	probably damaging	1.00
R2655:Ttll7	UTSW	3	146947621	missense	probably damaging	1.00
R2926:Ttll7	UTSW	3	146930415	nonsense	probably null
R4888:Ttll7	UTSW	3	146894177	start codon destroyed	probably null	0.99
R4999:Ttll7	UTSW	3	146894469	missense	probably damaging	1.00
R5648:Ttll7	UTSW	3	146961710	missense	probably damaging	1.00
R5937:Ttll7	UTSW	3	146944092	nonsense	probably null
R6009:Ttll7	UTSW	3	146934535	missense	probably damaging	0.99
R6036:Ttll7	UTSW	3	146940162	missense	probably benign
R6036:Ttll7	UTSW	3	146940162	missense	probably benign
R6747:Ttll7	UTSW	3	146944056	missense	probably benign	0.02
R6922:Ttll7	UTSW	3	146909614	missense	possibly damaging	0.92
R7123:Ttll7	UTSW	3	146913296	missense	possibly damaging	0.95
R7211:Ttll7	UTSW	3	146913276	missense	probably damaging	0.97
R8229:Ttll7	UTSW	3	146901449	missense	probably damaging	0.99
R8406:Ttll7	UTSW	3	146940024	missense	probably benign
R9343:Ttll7	UTSW	3	146961742	missense	probably damaging	1.00
R9348:Ttll7	UTSW	3	146968013	missense	probably benign	0.31
R9629:Ttll7	UTSW	3	146915732	missense	probably damaging	1.00
RF015:Ttll7	UTSW	3	146979658	missense	probably benign	0.00
X0024:Ttll7	UTSW	3	146909553	missense	probably damaging	1.00
X0026:Ttll7	UTSW	3	146961695	missense	probably damaging	1.00
X0027:Ttll7	UTSW	3	146947653	missense	probably damaging	1.00
Z1176:Ttll7	UTSW	3	146915771	missense	probably damaging	1.00
Z1176:Ttll7	UTSW	3	146930178	missense	probably benign	0.01
Z1176:Ttll7	UTSW	3	146947635	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGTGATCTTAGCTCCTGG -3'
(R):5'- ATGTGTATATATCTGTGTGCATGC -3'

Sequencing Primer
(F):5'- GATTGCGTCAGATTCTTGTAAGCAC -3'
(R):5'- TTTGCCCCATAAAGCACTGGG -3'

Posted On

2018-05-21