Mutagenetix > Incidental Mutation

Incidental Mutation 'R6463:Kif1b'

517675

Institutional Source

Beutler Lab

Gene Symbol

Kif1b

Ensembl Gene

ENSMUSG00000063077

Gene Name

kinesin family member 1B

Synonyms

Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149176319-149307693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149192596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1337 (M1337V)

Ref Sequence

ENSEMBL: ENSMUSP00000061472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]

AlphaFold

Q60575

Predicted Effect

probably benign
Transcript: ENSMUST00000055647
AA Change: M1337V

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: M1337V

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	685	N/A	INTRINSIC
Pfam:KIF1B	799	846	9.7e-13	PFAM
internal_repeat_1	901	933	7.01e-7	PROSPERO
low complexity region	1165	1179	N/A	INTRINSIC
Pfam:DUF3694	1220	1368	1.1e-46	PFAM
low complexity region	1444	1461	N/A	INTRINSIC
low complexity region	1479	1507	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC
PH	1656	1755	1.02e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000060537
AA Change: M1383V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: M1383V

Domain	Start	End	E-Value	Type
KISc	3	362	7.61e-175	SMART
low complexity region	390	400	N/A	INTRINSIC
low complexity region	432	450	N/A	INTRINSIC
FHA	555	612	1.61e-4	SMART
coiled coil region	672	731	N/A	INTRINSIC
Pfam:KIF1B	845	892	7.1e-15	PFAM
internal_repeat_1	947	979	4.76e-7	PROSPERO
low complexity region	1211	1225	N/A	INTRINSIC
Pfam:DUF3694	1266	1413	1.1e-40	PFAM
low complexity region	1490	1507	N/A	INTRINSIC
low complexity region	1525	1553	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
PH	1702	1801	1.02e-14	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000139123
AA Change: M61V

SMART Domains

Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077
AA Change: M61V

Domain	Start	End	E-Value	Type
Pfam:DUF3694	1	92	4.4e-23	PFAM
low complexity region	169	186	N/A	INTRINSIC
low complexity region	204	232	N/A	INTRINSIC
low complexity region	298	316	N/A	INTRINSIC
PH	381	480	1.02e-14	SMART

Meta Mutation Damage Score

0.0743

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,938	H48L	probably damaging	Het
Aifm3	A	G	16: 17,500,789	I185V	probably benign	Het
Asb7	A	T	7: 66,660,236	D77E	probably damaging	Het
Cacna1i	T	C	15: 80,355,758	I336T	probably damaging	Het
Cadps2	A	T	6: 23,323,334	L1016*	probably null	Het
Ccdc129	A	G	6: 55,968,678	R795G	probably benign	Het
Cep63	C	A	9: 102,596,155	M504I	probably benign	Het
Chpf2	G	T	5: 24,589,526	L231F	probably damaging	Het
Cnot10	T	C	9: 114,625,902	Y221C	probably damaging	Het
Col3a1	G	A	1: 45,342,205		probably benign	Het
Csl	T	C	10: 99,759,098	D35G	probably damaging	Het
Csmd3	T	C	15: 47,676,479	Y2286C	probably damaging	Het
Dbt	A	G	3: 116,539,760	E293G	possibly damaging	Het
Ddx31	T	A	2: 28,847,513		probably null	Het
Dnm1	T	C	2: 32,309,591		probably benign	Het
Elfn1	A	G	5: 139,972,285	Y348C	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha5	T	A	5: 84,106,710	I657F	probably damaging	Het
Fbp1	A	G	13: 62,865,010	F123S	possibly damaging	Het
Hkdc1	T	C	10: 62,393,702	N732S	probably damaging	Het
Itfg1	A	G	8: 85,736,151	S448P	probably benign	Het
Izumo2	A	G	7: 44,709,074	K84R	probably benign	Het
Kbtbd3	A	G	9: 4,316,921	Y24C	probably benign	Het
Mdn1	T	C	4: 32,773,308	L5489P	probably damaging	Het
Mettl2	G	A	11: 105,132,581		probably null	Het
Mtr	T	C	13: 12,216,866	T651A	probably benign	Het
Naglu	A	G	11: 101,077,351		probably null	Het
Nkx6-1	G	T	5: 101,659,476	H347N	probably damaging	Het
Ntpcr	A	G	8: 125,736,104	E20G	probably benign	Het
Oas2	T	C	5: 120,734,981	R670G	probably null	Het
Olfr1208	T	C	2: 88,897,118	I160V	probably benign	Het
Olfr239	G	A	17: 33,199,638	V197I	probably benign	Het
Olfr698	C	G	7: 106,752,801	E196Q	probably benign	Het
Phldb2	A	C	16: 45,774,993	V902G	probably benign	Het
Rdh7	T	C	10: 127,885,781	R209G	probably benign	Het
Slc13a3	A	C	2: 165,445,653	L127R	probably damaging	Het
Slc6a20b	T	A	9: 123,604,949	I275F	possibly damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tmx4	T	C	2: 134,620,639	Y124C	probably damaging	Het
Trh	A	T	6: 92,242,843	M164K	possibly damaging	Het
Trhr	A	G	15: 44,197,585	N167S	probably benign	Het
Ttll7	G	A	3: 146,931,582	R490Q	possibly damaging	Het
Uck1	T	C	2: 32,258,655	N100S	probably benign	Het
Ucp3	A	T	7: 100,480,269	T104S	probably benign	Het
Vmn2r28	T	A	7: 5,486,436	H468L	probably benign	Het
Xaf1	G	A	11: 72,308,638	R67H	probably benign	Het
Ypel4	T	C	2: 84,736,743		probably benign	Het
Zfp687	A	G	3: 95,010,784	I559T	probably damaging	Het

Other mutations in Kif1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Kif1b	APN	4	149220602	missense	probably damaging	1.00
IGL01943:Kif1b	APN	4	149214905	critical splice donor site	probably null
IGL02240:Kif1b	APN	4	149246414	missense	probably damaging	1.00
IGL02414:Kif1b	APN	4	149199314	missense	probably damaging	0.96
IGL02490:Kif1b	APN	4	149204208	missense	probably benign
IGL02501:Kif1b	APN	4	149214976	missense	probably damaging	1.00
IGL02833:Kif1b	APN	4	149246364	missense	probably damaging	1.00
IGL02852:Kif1b	APN	4	149291328	missense	probably damaging	1.00
IGL02900:Kif1b	APN	4	149180809	missense	possibly damaging	0.81
IGL03287:Kif1b	APN	4	149214981	missense	possibly damaging	0.67
IGL03412:Kif1b	APN	4	149274939	missense	probably benign	0.00
PIT4305001:Kif1b	UTSW	4	149220792	critical splice acceptor site	probably null
R0005:Kif1b	UTSW	4	149181927	missense	probably damaging	1.00
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0129:Kif1b	UTSW	4	149261201	missense	probably benign
R0180:Kif1b	UTSW	4	149213659	missense	probably damaging	1.00
R0288:Kif1b	UTSW	4	149199338	missense	probably damaging	1.00
R0360:Kif1b	UTSW	4	149262729	missense	probably damaging	1.00
R0383:Kif1b	UTSW	4	149202512	missense	probably damaging	1.00
R0398:Kif1b	UTSW	4	149204231	missense	possibly damaging	0.89
R0403:Kif1b	UTSW	4	149181967	nonsense	probably null
R0445:Kif1b	UTSW	4	149188009	missense	probably benign	0.01
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1681:Kif1b	UTSW	4	149195501	critical splice acceptor site	probably null
R1728:Kif1b	UTSW	4	149187722	missense	probably damaging	0.99
R1840:Kif1b	UTSW	4	149188132	missense	probably damaging	1.00
R1874:Kif1b	UTSW	4	149187632	missense	probably benign
R1915:Kif1b	UTSW	4	149267216	missense	probably damaging	1.00
R2106:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2124:Kif1b	UTSW	4	149222296	missense	probably benign	0.08
R2126:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2127:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2128:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2129:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2146:Kif1b	UTSW	4	149184309	missense	probably damaging	0.99
R2255:Kif1b	UTSW	4	149274997	missense	probably damaging	1.00
R2392:Kif1b	UTSW	4	149220620	missense	possibly damaging	0.93
R2883:Kif1b	UTSW	4	149237648	missense	possibly damaging	0.78
R2981:Kif1b	UTSW	4	149220541	critical splice donor site	probably null
R3038:Kif1b	UTSW	4	149213333	missense	probably benign	0.02
R3616:Kif1b	UTSW	4	149262283	splice site	probably benign
R3935:Kif1b	UTSW	4	149237160	missense	probably benign	0.00
R4347:Kif1b	UTSW	4	149247234	missense	probably damaging	1.00
R4423:Kif1b	UTSW	4	149214105	missense	probably damaging	0.99
R4637:Kif1b	UTSW	4	149199311	missense	probably damaging	0.97
R4745:Kif1b	UTSW	4	149237882	nonsense	probably null
R4807:Kif1b	UTSW	4	149247921	intron	probably benign
R5618:Kif1b	UTSW	4	149269889	missense	possibly damaging	0.94
R5644:Kif1b	UTSW	4	149238482	missense	probably damaging	0.96
R5683:Kif1b	UTSW	4	149222261	missense	probably damaging	1.00
R5696:Kif1b	UTSW	4	149273849	splice site	probably null
R6022:Kif1b	UTSW	4	149198532	missense	probably benign	0.01
R6048:Kif1b	UTSW	4	149263629	missense	probably damaging	1.00
R6137:Kif1b	UTSW	4	149238426	missense	possibly damaging	0.47
R6139:Kif1b	UTSW	4	149237532	missense	possibly damaging	0.88
R6171:Kif1b	UTSW	4	149258048	missense	probably damaging	1.00
R6250:Kif1b	UTSW	4	149213643	missense	probably benign	0.00
R6423:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6424:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6425:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6443:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6460:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6462:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6469:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6470:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6471:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6472:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6504:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6536:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6537:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6668:Kif1b	UTSW	4	149213407	missense	probably benign	0.09
R6698:Kif1b	UTSW	4	149274956	missense	probably damaging	0.99
R7065:Kif1b	UTSW	4	149202525	missense	possibly damaging	0.46
R7222:Kif1b	UTSW	4	149225157	missense	probably damaging	1.00
R7342:Kif1b	UTSW	4	149214090	missense	possibly damaging	0.94
R7720:Kif1b	UTSW	4	149182355	missense	probably benign	0.01
R7744:Kif1b	UTSW	4	149237075	missense	possibly damaging	0.83
R7797:Kif1b	UTSW	4	149237387	missense	probably benign
R7829:Kif1b	UTSW	4	149220990	splice site	probably null
R7869:Kif1b	UTSW	4	149184376	missense	probably benign	0.01
R7878:Kif1b	UTSW	4	149214997	missense	probably damaging	0.98
R7980:Kif1b	UTSW	4	149269921	missense	probably damaging	1.00
R8047:Kif1b	UTSW	4	149214922	missense	probably damaging	1.00
R8237:Kif1b	UTSW	4	149191185	missense	probably benign	0.10
R8243:Kif1b	UTSW	4	149204267	missense	probably benign
R8252:Kif1b	UTSW	4	149273805	missense	probably damaging	1.00
R8342:Kif1b	UTSW	4	149222348	missense	probably damaging	0.96
R8460:Kif1b	UTSW	4	149187620	missense	possibly damaging	0.93
R8462:Kif1b	UTSW	4	149182340	missense	probably benign	0.05
R8496:Kif1b	UTSW	4	149192611	nonsense	probably null
R8687:Kif1b	UTSW	4	149261163	nonsense	probably null
R8694:Kif1b	UTSW	4	149220567	missense	probably damaging	0.98
R8842:Kif1b	UTSW	4	149253739	missense	probably damaging	0.98
R8883:Kif1b	UTSW	4	149276885	missense	probably benign
R8971:Kif1b	UTSW	4	149247816	missense	probably damaging	1.00
R8994:Kif1b	UTSW	4	149195482	missense
R9002:Kif1b	UTSW	4	149191255	missense	probably damaging	0.96
R9227:Kif1b	UTSW	4	149237900	missense	probably damaging	1.00
R9231:Kif1b	UTSW	4	149191195	missense	possibly damaging	0.94
R9450:Kif1b	UTSW	4	149238010	missense	probably benign	0.01
R9478:Kif1b	UTSW	4	149261159	critical splice donor site	probably null
R9571:Kif1b	UTSW	4	149220641	missense	probably damaging	1.00
R9644:Kif1b	UTSW	4	149291379	missense	probably damaging	1.00
RF008:Kif1b	UTSW	4	149251738	splice site	probably null
X0009:Kif1b	UTSW	4	149247264	missense	probably damaging	1.00
X0062:Kif1b	UTSW	4	149275005	missense	probably damaging	1.00
Z1176:Kif1b	UTSW	4	149266298	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GAGCCCTGGAATAGAATCTAAAAC -3'
(R):5'- TTCCTTAGAACACTGCCAGTAG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGATTTCCAGG -3'
(R):5'- GCCAGTAGCAATCCCTCTG -3'

Posted On

2018-05-21