Incidental Mutation 'R6463:Chpf2'
ID517676
Institutional Source Beutler Lab
Gene Symbol Chpf2
Ensembl Gene ENSMUSG00000038181
Gene Namechondroitin polymerizing factor 2
Synonyms2010209O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6463 (G1)
Quality Score192.009
Status Validated
Chromosome5
Chromosomal Location24586741-24594556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24589526 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 231 (L231F)
Ref Sequence ENSEMBL: ENSMUSP00000112804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably benign
Transcript: ENSMUST00000030791
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000088295
AA Change: L231F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181
AA Change: L231F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102432
Predicted Effect probably damaging
Transcript: ENSMUST00000121863
AA Change: L231F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181
AA Change: L231F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144995
Predicted Effect probably benign
Transcript: ENSMUST00000195943
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198521
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Chpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chpf2 APN 5 24592261 missense probably damaging 1.00
IGL02110:Chpf2 APN 5 24591712 missense probably damaging 1.00
IGL02625:Chpf2 APN 5 24591711 nonsense probably null
IGL02673:Chpf2 APN 5 24591304 missense probably benign 0.21
R0545:Chpf2 UTSW 5 24590324 missense possibly damaging 0.89
R0571:Chpf2 UTSW 5 24590427 missense probably damaging 1.00
R0732:Chpf2 UTSW 5 24590421 start codon destroyed probably null 0.94
R1196:Chpf2 UTSW 5 24589648 missense possibly damaging 0.61
R2051:Chpf2 UTSW 5 24591276 missense probably benign 0.00
R2057:Chpf2 UTSW 5 24591222 missense probably damaging 1.00
R2147:Chpf2 UTSW 5 24592035 missense probably damaging 1.00
R3719:Chpf2 UTSW 5 24590312 nonsense probably null
R4168:Chpf2 UTSW 5 24591790 missense possibly damaging 0.86
R4632:Chpf2 UTSW 5 24591831 missense probably benign
R5278:Chpf2 UTSW 5 24588090 intron probably benign
R5481:Chpf2 UTSW 5 24589342 missense probably damaging 1.00
R5853:Chpf2 UTSW 5 24592192 missense probably damaging 1.00
R5914:Chpf2 UTSW 5 24592423 unclassified probably benign
R6010:Chpf2 UTSW 5 24591919 missense probably damaging 1.00
R6340:Chpf2 UTSW 5 24591775 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGGGCAGACTATGACTGG -3'
(R):5'- GTCTGGAGAATTCAGTTTGGACAG -3'

Sequencing Primer
(F):5'- GGTTCTTCATCATGCAGGACGAC -3'
(R):5'- TGGACAGCAATCATTCAGTCACTG -3'
Posted On2018-05-21