Incidental Mutation 'R6463:Trh'
ID517683
Institutional Source Beutler Lab
Gene Symbol Trh
Ensembl Gene ENSMUSG00000005892
Gene Namethyrotropin releasing hormone
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6463 (G1)
Quality Score218.009
Status Validated
Chromosome6
Chromosomal Location92242061-92244650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92242843 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 164 (M164K)
Ref Sequence ENSEMBL: ENSMUSP00000006046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006046
AA Change: M164K

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006046
Gene: ENSMUSG00000005892
AA Change: M164K

DomainStartEndE-ValueType
Pfam:TRH 6 125 5.4e-16 PFAM
Pfam:TRH 140 224 2.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a member of the thyrotropin-releasing hormone family. Cleavage of the encoded proprotein releases mature thyrotropin-releasing hormone, which is a tripeptide hypothalamic regulatory hormone. The mouse proprotein contains five thyrotropin-releasing hormone tripeptides. Thyrotropin-releasing hormone is involved in the regulation and release of thyroid-stimulating hormone, as well as prolactin. Disruption of this gene results in hypothyroidism, elevated thyroid-stimulating hormone levels, and hyperglycemia. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high postnatal mortality, impaired thermoregulation, and loss of white fat. Survivors show ketosis, microvesicular fat accumulation, elevated serum lipids, and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Trh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Trh APN 6 92242742 missense possibly damaging 0.77
IGL00835:Trh APN 6 92242789 missense probably benign 0.26
IGL01978:Trh APN 6 92242615 missense probably benign
IGL02157:Trh APN 6 92242967 missense probably benign
IGL02997:Trh APN 6 92243134 splice site probably benign
IGL03039:Trh APN 6 92243728 missense probably damaging 0.99
IGL03132:Trh APN 6 92243774 missense probably benign 0.01
IGL02991:Trh UTSW 6 92243738 missense probably damaging 1.00
R0464:Trh UTSW 6 92243668 splice site probably null
R3079:Trh UTSW 6 92242570 missense possibly damaging 0.81
R3874:Trh UTSW 6 92243698 missense possibly damaging 0.74
R3875:Trh UTSW 6 92243698 missense possibly damaging 0.74
R5357:Trh UTSW 6 92242834 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTTGGCCACAAATCCCCTGG -3'
(R):5'- GATTCCTGGATCACAAAACGCC -3'

Sequencing Primer
(F):5'- AAATCCCCTGGGGCCCAC -3'
(R):5'- CCAGCATCCGGGCAAAAGG -3'
Posted On2018-05-21