Incidental Mutation 'R6463:Vmn2r28'
ID517684
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Namevomeronasal 2, receptor 28
SynonymsEG665255
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5479531-5493967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5486436 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 468 (H468L)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
Predicted Effect probably benign
Transcript: ENSMUST00000086297
AA Change: H468L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: H468L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5488069 missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5488184 missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5486478 missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5481088 missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5486464 missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5488162 missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5481303 missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5488124 missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5490569 missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5481004 missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5484016 missense probably damaging 0.98
R0288:Vmn2r28 UTSW 7 5488021 missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5493716 missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5488514 missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5490457 missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5488690 missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5481302 missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5481545 missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5493811 missense probably benign
R1853:Vmn2r28 UTSW 7 5481247 nonsense probably null
R1869:Vmn2r28 UTSW 7 5486346 missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5488289 missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5481071 missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5488314 missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5484131 missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5488702 missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5481392 missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5488358 missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5490708 missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5480672 missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5486377 missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5487944 critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5484012 missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5488669 missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5493791 missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5488004 nonsense probably null
R6276:Vmn2r28 UTSW 7 5490731 missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5488475 missense probably benign 0.00
R6528:Vmn2r28 UTSW 7 5490685 missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5481230 missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5480807 missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5490734 missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5481496 missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5481309 missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5488201 missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5481256 missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5493679 missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
R7945:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTTGAGAGTGTTTACTGCTATG -3'
(R):5'- CACACATGCGTTTGGTTCTGC -3'

Sequencing Primer
(F):5'- TGCTGTAGCCAACTCAAG -3'
(R):5'- CGTAGTTGCCTTTATTATGGAATCAG -3'
Posted On2018-05-21