Incidental Mutation 'R6463:Vmn2r28'
ID 517684
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Name vomeronasal 2, receptor 28
Synonyms EG665255
MMRRC Submission 045324-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # R6463 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5483455-5496850 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5489435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 468 (H468L)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
AlphaFold L7N203
Predicted Effect probably benign
Transcript: ENSMUST00000086297
AA Change: H468L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: H468L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 (GRCm39) H48L probably damaging Het
Aifm3 A G 16: 17,318,653 (GRCm39) I185V probably benign Het
Asb7 A T 7: 66,309,984 (GRCm39) D77E probably damaging Het
Cacna1i T C 15: 80,239,959 (GRCm39) I336T probably damaging Het
Cadps2 A T 6: 23,323,333 (GRCm39) L1016* probably null Het
Cep63 C A 9: 102,473,354 (GRCm39) M504I probably benign Het
Chpf2 G T 5: 24,794,524 (GRCm39) L231F probably damaging Het
Cnot10 T C 9: 114,454,970 (GRCm39) Y221C probably damaging Het
Col3a1 G A 1: 45,381,365 (GRCm39) probably benign Het
Csl T C 10: 99,594,960 (GRCm39) D35G probably damaging Het
Csmd3 T C 15: 47,539,875 (GRCm39) Y2286C probably damaging Het
Dbt A G 3: 116,333,409 (GRCm39) E293G possibly damaging Het
Ddx31 T A 2: 28,737,525 (GRCm39) probably null Het
Dnm1 T C 2: 32,199,603 (GRCm39) probably benign Het
Elfn1 A G 5: 139,958,040 (GRCm39) Y348C probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epha5 T A 5: 84,254,569 (GRCm39) I657F probably damaging Het
Fbp1 A G 13: 63,012,824 (GRCm39) F123S possibly damaging Het
Hkdc1 T C 10: 62,229,481 (GRCm39) N732S probably damaging Het
Itfg1 A G 8: 86,462,780 (GRCm39) S448P probably benign Het
Itprid1 A G 6: 55,945,663 (GRCm39) R795G probably benign Het
Izumo2 A G 7: 44,358,498 (GRCm39) K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 (GRCm39) Y24C probably benign Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Mdn1 T C 4: 32,773,308 (GRCm39) L5489P probably damaging Het
Mettl2 G A 11: 105,023,407 (GRCm39) probably null Het
Mtr T C 13: 12,231,752 (GRCm39) T651A probably benign Het
Naglu A G 11: 100,968,177 (GRCm39) probably null Het
Nkx6-1 G T 5: 101,807,342 (GRCm39) H347N probably damaging Het
Ntpcr A G 8: 126,462,843 (GRCm39) E20G probably benign Het
Oas2 T C 5: 120,873,046 (GRCm39) R670G probably null Het
Or10h1 G A 17: 33,418,612 (GRCm39) V197I probably benign Het
Or2ag16 C G 7: 106,352,008 (GRCm39) E196Q probably benign Het
Or4p8 T C 2: 88,727,462 (GRCm39) I160V probably benign Het
Phldb2 A C 16: 45,595,356 (GRCm39) V902G probably benign Het
Rdh7 T C 10: 127,721,650 (GRCm39) R209G probably benign Het
Slc13a3 A C 2: 165,287,573 (GRCm39) L127R probably damaging Het
Slc6a20b T A 9: 123,434,014 (GRCm39) I275F possibly damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Tmx4 T C 2: 134,462,559 (GRCm39) Y124C probably damaging Het
Trh A T 6: 92,219,824 (GRCm39) M164K possibly damaging Het
Trhr A G 15: 44,060,981 (GRCm39) N167S probably benign Het
Ttll7 G A 3: 146,637,337 (GRCm39) R490Q possibly damaging Het
Uck1 T C 2: 32,148,667 (GRCm39) N100S probably benign Het
Ucp3 A T 7: 100,129,476 (GRCm39) T104S probably benign Het
Xaf1 G A 11: 72,199,464 (GRCm39) R67H probably benign Het
Ypel4 T C 2: 84,567,087 (GRCm39) probably benign Het
Zfp687 A G 3: 94,918,095 (GRCm39) I559T probably damaging Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5,491,068 (GRCm39) missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5,491,183 (GRCm39) missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5,489,477 (GRCm39) missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5,484,087 (GRCm39) missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5,489,463 (GRCm39) missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5,491,161 (GRCm39) missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5,484,302 (GRCm39) missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5,491,123 (GRCm39) missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5,493,568 (GRCm39) missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5,484,003 (GRCm39) missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5,487,015 (GRCm39) missense probably damaging 0.98
G1patch:Vmn2r28 UTSW 7 5,491,408 (GRCm39) missense probably benign 0.13
R0288:Vmn2r28 UTSW 7 5,491,020 (GRCm39) missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5,496,715 (GRCm39) missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5,491,513 (GRCm39) missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5,493,456 (GRCm39) missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5,491,689 (GRCm39) missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5,491,026 (GRCm39) missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5,484,301 (GRCm39) missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5,484,544 (GRCm39) missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5,496,810 (GRCm39) missense probably benign
R1853:Vmn2r28 UTSW 7 5,484,246 (GRCm39) nonsense probably null
R1869:Vmn2r28 UTSW 7 5,489,345 (GRCm39) missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5,491,288 (GRCm39) missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5,484,070 (GRCm39) missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5,491,313 (GRCm39) missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5,487,130 (GRCm39) missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5,491,701 (GRCm39) missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5,484,391 (GRCm39) missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5,491,026 (GRCm39) missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5,491,357 (GRCm39) missense probably damaging 1.00
R4307:Vmn2r28 UTSW 7 5,493,707 (GRCm39) missense probably damaging 0.99
R5023:Vmn2r28 UTSW 7 5,489,463 (GRCm39) missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5,489,463 (GRCm39) missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5,483,671 (GRCm39) missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5,489,376 (GRCm39) missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5,490,943 (GRCm39) critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5,487,011 (GRCm39) missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5,491,668 (GRCm39) missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5,496,790 (GRCm39) missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5,491,003 (GRCm39) nonsense probably null
R6276:Vmn2r28 UTSW 7 5,493,730 (GRCm39) missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5,491,474 (GRCm39) missense probably benign 0.00
R6528:Vmn2r28 UTSW 7 5,493,684 (GRCm39) missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5,491,408 (GRCm39) missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5,484,229 (GRCm39) missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5,483,806 (GRCm39) missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5,493,733 (GRCm39) missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5,484,495 (GRCm39) missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5,484,308 (GRCm39) missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5,491,200 (GRCm39) missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5,484,255 (GRCm39) missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5,496,678 (GRCm39) missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5,493,613 (GRCm39) missense probably benign 0.00
R7916:Vmn2r28 UTSW 7 5,483,818 (GRCm39) missense probably damaging 1.00
R8183:Vmn2r28 UTSW 7 5,491,147 (GRCm39) missense probably damaging 1.00
R8334:Vmn2r28 UTSW 7 5,487,059 (GRCm39) missense probably damaging 1.00
R8519:Vmn2r28 UTSW 7 5,489,347 (GRCm39) missense probably benign 0.31
R8989:Vmn2r28 UTSW 7 5,493,473 (GRCm39) missense probably benign 0.00
R9066:Vmn2r28 UTSW 7 5,491,596 (GRCm39) missense probably damaging 1.00
R9422:Vmn2r28 UTSW 7 5,483,747 (GRCm39) missense probably damaging 1.00
R9469:Vmn2r28 UTSW 7 5,487,118 (GRCm39) missense probably damaging 0.99
R9608:Vmn2r28 UTSW 7 5,491,220 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACTTGAGAGTGTTTACTGCTATG -3'
(R):5'- CACACATGCGTTTGGTTCTGC -3'

Sequencing Primer
(F):5'- TGCTGTAGCCAACTCAAG -3'
(R):5'- CGTAGTTGCCTTTATTATGGAATCAG -3'
Posted On 2018-05-21