Mutagenetix > Incidental Mutation

Incidental Mutation 'R6463:Ucp3'

517687

Institutional Source

Beutler Lab

Gene Symbol

Ucp3

Ensembl Gene

ENSMUSG00000032942

Gene Name

uncoupling protein 3 (mitochondrial, proton carrier)

Synonyms

Slc25a9, UCP-3

MMRRC Submission

045324-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R6463 (G1)

Quality Score

202.009

Status

Validated

Chromosome

Chromosomal Location

100122198-100135639 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100129476 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 104 (T104S)

Ref Sequence

ENSEMBL: ENSMUSP00000102674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]

AlphaFold

P56501

Predicted Effect

probably benign
Transcript: ENSMUST00000032958
AA Change: T104S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: T104S

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	3.1e-20	PFAM
Pfam:Mito_carr	109	207	9.6e-26	PFAM
Pfam:Mito_carr	210	301	2.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107059
AA Change: T104S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: T104S

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	9	107	5.9e-22	PFAM
Pfam:Mito_carr	109	207	1.7e-27	PFAM
Pfam:Mito_carr	209	301	9.4e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133850

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,938 (GRCm39)	H48L	probably damaging	Het
Aifm3	A	G	16: 17,318,653 (GRCm39)	I185V	probably benign	Het
Asb7	A	T	7: 66,309,984 (GRCm39)	D77E	probably damaging	Het
Cacna1i	T	C	15: 80,239,959 (GRCm39)	I336T	probably damaging	Het
Cadps2	A	T	6: 23,323,333 (GRCm39)	L1016*	probably null	Het
Cep63	C	A	9: 102,473,354 (GRCm39)	M504I	probably benign	Het
Chpf2	G	T	5: 24,794,524 (GRCm39)	L231F	probably damaging	Het
Cnot10	T	C	9: 114,454,970 (GRCm39)	Y221C	probably damaging	Het
Col3a1	G	A	1: 45,381,365 (GRCm39)		probably benign	Het
Csl	T	C	10: 99,594,960 (GRCm39)	D35G	probably damaging	Het
Csmd3	T	C	15: 47,539,875 (GRCm39)	Y2286C	probably damaging	Het
Dbt	A	G	3: 116,333,409 (GRCm39)	E293G	possibly damaging	Het
Ddx31	T	A	2: 28,737,525 (GRCm39)		probably null	Het
Dnm1	T	C	2: 32,199,603 (GRCm39)		probably benign	Het
Elfn1	A	G	5: 139,958,040 (GRCm39)	Y348C	probably damaging	Het
Enpp5	G	A	17: 44,396,155 (GRCm39)	G356S	probably damaging	Het
Epha5	T	A	5: 84,254,569 (GRCm39)	I657F	probably damaging	Het
Fbp1	A	G	13: 63,012,824 (GRCm39)	F123S	possibly damaging	Het
Hkdc1	T	C	10: 62,229,481 (GRCm39)	N732S	probably damaging	Het
Itfg1	A	G	8: 86,462,780 (GRCm39)	S448P	probably benign	Het
Itprid1	A	G	6: 55,945,663 (GRCm39)	R795G	probably benign	Het
Izumo2	A	G	7: 44,358,498 (GRCm39)	K84R	probably benign	Het
Kbtbd3	A	G	9: 4,316,921 (GRCm39)	Y24C	probably benign	Het
Kif1b	T	C	4: 149,277,053 (GRCm39)	M1337V	probably benign	Het
Mdn1	T	C	4: 32,773,308 (GRCm39)	L5489P	probably damaging	Het
Mettl2	G	A	11: 105,023,407 (GRCm39)		probably null	Het
Mtr	T	C	13: 12,231,752 (GRCm39)	T651A	probably benign	Het
Naglu	A	G	11: 100,968,177 (GRCm39)		probably null	Het
Nkx6-1	G	T	5: 101,807,342 (GRCm39)	H347N	probably damaging	Het
Ntpcr	A	G	8: 126,462,843 (GRCm39)	E20G	probably benign	Het
Oas2	T	C	5: 120,873,046 (GRCm39)	R670G	probably null	Het
Or10h1	G	A	17: 33,418,612 (GRCm39)	V197I	probably benign	Het
Or2ag16	C	G	7: 106,352,008 (GRCm39)	E196Q	probably benign	Het
Or4p8	T	C	2: 88,727,462 (GRCm39)	I160V	probably benign	Het
Phldb2	A	C	16: 45,595,356 (GRCm39)	V902G	probably benign	Het
Rdh7	T	C	10: 127,721,650 (GRCm39)	R209G	probably benign	Het
Slc13a3	A	C	2: 165,287,573 (GRCm39)	L127R	probably damaging	Het
Slc6a20b	T	A	9: 123,434,014 (GRCm39)	I275F	possibly damaging	Het
St3gal1	A	G	15: 66,983,195 (GRCm39)	V187A	possibly damaging	Het
Tmx4	T	C	2: 134,462,559 (GRCm39)	Y124C	probably damaging	Het
Trh	A	T	6: 92,219,824 (GRCm39)	M164K	possibly damaging	Het
Trhr	A	G	15: 44,060,981 (GRCm39)	N167S	probably benign	Het
Ttll7	G	A	3: 146,637,337 (GRCm39)	R490Q	possibly damaging	Het
Uck1	T	C	2: 32,148,667 (GRCm39)	N100S	probably benign	Het
Vmn2r28	T	A	7: 5,489,435 (GRCm39)	H468L	probably benign	Het
Xaf1	G	A	11: 72,199,464 (GRCm39)	R67H	probably benign	Het
Ypel4	T	C	2: 84,567,087 (GRCm39)		probably benign	Het
Zfp687	A	G	3: 94,918,095 (GRCm39)	I559T	probably damaging	Het

Other mutations in Ucp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Ucp3	APN	7	100,129,766 (GRCm39)	missense	probably damaging	1.00
IGL02883:Ucp3	APN	7	100,129,849 (GRCm39)	missense	probably benign	0.00
IGL03137:Ucp3	APN	7	100,131,969 (GRCm39)	splice site	probably benign
PIT4576001:Ucp3	UTSW	7	100,129,458 (GRCm39)	missense	probably benign	0.04
R0023:Ucp3	UTSW	7	100,134,250 (GRCm39)	missense	probably benign	0.00
R0023:Ucp3	UTSW	7	100,134,250 (GRCm39)	missense	probably benign	0.00
R0532:Ucp3	UTSW	7	100,131,186 (GRCm39)	splice site	probably benign
R0616:Ucp3	UTSW	7	100,129,368 (GRCm39)	missense	probably benign	0.00
R0833:Ucp3	UTSW	7	100,128,748 (GRCm39)	nonsense	probably null
R1739:Ucp3	UTSW	7	100,131,927 (GRCm39)	missense	probably benign	0.01
R1939:Ucp3	UTSW	7	100,129,871 (GRCm39)	missense	probably benign	0.00
R3861:Ucp3	UTSW	7	100,129,458 (GRCm39)	missense	probably benign	0.04
R3958:Ucp3	UTSW	7	100,131,946 (GRCm39)	missense	probably benign	0.00
R3959:Ucp3	UTSW	7	100,131,946 (GRCm39)	missense	probably benign	0.00
R4059:Ucp3	UTSW	7	100,131,871 (GRCm39)	missense	probably damaging	0.99
R5535:Ucp3	UTSW	7	100,129,873 (GRCm39)	missense	probably benign	0.45
R6596:Ucp3	UTSW	7	100,131,140 (GRCm39)	missense	probably benign	0.01
R7517:Ucp3	UTSW	7	100,131,089 (GRCm39)	missense	probably damaging	1.00
R7693:Ucp3	UTSW	7	100,131,799 (GRCm39)	missense	probably benign	0.00
R9487:Ucp3	UTSW	7	100,131,123 (GRCm39)	missense	probably damaging	1.00
R9493:Ucp3	UTSW	7	100,131,911 (GRCm39)	missense	probably benign	0.00
Z1177:Ucp3	UTSW	7	100,129,799 (GRCm39)	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ATCATGCAGTTCCTACAGGCG -3'
(R):5'- AATCTCACCAGTGTCTGTCATC -3'

Sequencing Primer
(F):5'- TTGTTCCCCAGATCCAAGGG -3'
(R):5'- ACCAGTGTCTGTCATCAGCTTG -3'

Posted On

2018-05-21