Incidental Mutation 'R6463:Olfr698'
ID 517688
Institutional Source Beutler Lab
Gene Symbol Olfr698
Ensembl Gene ENSMUSG00000059087
Gene Name olfactory receptor 698
Synonyms MOR283-3, GA_x6K02T2PBJ9-9130754-9129519
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R6463 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106749889-106755397 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 106752801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 196 (E196Q)
Ref Sequence ENSEMBL: ENSMUSP00000149305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074981] [ENSMUST00000214306] [ENSMUST00000216255]
AlphaFold Q7TRN4
Predicted Effect probably benign
Transcript: ENSMUST00000074981
AA Change: E196Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074509
Gene: ENSMUSG00000059087
AA Change: E196Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.8e-8 PFAM
Pfam:7tm_1 41 290 4.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214306
AA Change: E196Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215892
Predicted Effect probably benign
Transcript: ENSMUST00000216255
AA Change: E196Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.3297 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Olfr698
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Olfr698 APN 7 106752446 utr 3 prime probably benign
IGL01901:Olfr698 APN 7 106752545 missense possibly damaging 0.52
IGL01912:Olfr698 APN 7 106752992 missense probably damaging 1.00
IGL01998:Olfr698 APN 7 106752551 missense possibly damaging 0.63
IGL02640:Olfr698 APN 7 106753352 missense probably damaging 1.00
IGL03195:Olfr698 APN 7 106752773 missense probably benign
R0255:Olfr698 UTSW 7 106752989 missense probably benign 0.19
R1104:Olfr698 UTSW 7 106752782 missense probably benign 0.37
R1796:Olfr698 UTSW 7 106752549 missense probably benign 0.02
R1909:Olfr698 UTSW 7 106752995 missense probably benign 0.21
R4133:Olfr698 UTSW 7 106753079 missense probably damaging 0.98
R5194:Olfr698 UTSW 7 106753219 missense probably benign 0.15
R5389:Olfr698 UTSW 7 106753083 missense probably damaging 0.99
R5426:Olfr698 UTSW 7 106752566 missense probably benign
R6162:Olfr698 UTSW 7 106753020 missense probably damaging 1.00
R6643:Olfr698 UTSW 7 106752569 missense probably benign 0.41
R6831:Olfr698 UTSW 7 106752571 missense probably damaging 0.99
R6972:Olfr698 UTSW 7 106752699 missense possibly damaging 0.60
R7392:Olfr698 UTSW 7 106753382 missense possibly damaging 0.69
R7717:Olfr698 UTSW 7 106752636 missense possibly damaging 0.58
R7852:Olfr698 UTSW 7 106752638 missense probably damaging 0.98
R8073:Olfr698 UTSW 7 106752801 nonsense probably null
R8245:Olfr698 UTSW 7 106753167 missense probably benign 0.03
R8698:Olfr698 UTSW 7 106753364 missense probably benign 0.05
R9192:Olfr698 UTSW 7 106753223 missense probably damaging 1.00
R9333:Olfr698 UTSW 7 106752575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGAGTGACAATCGTGTAG -3'
(R):5'- GTCACAAAGTCTGCTGGCTC -3'

Sequencing Primer
(F):5'- CGTGTAGAAAACTGAGCTGATATTG -3'
(R):5'- CAAAGTCTGCTGGCTCATGATAGC -3'
Posted On 2018-05-21