Incidental Mutation 'R6463:Cep63'
ID517692
Institutional Source Beutler Lab
Gene Symbol Cep63
Ensembl Gene ENSMUSG00000032534
Gene Namecentrosomal protein 63
SynonymsD9Mgc48e, CD20R, D9Mgc41, ET2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location102584588-102626534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102596155 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 504 (M504I)
Ref Sequence ENSEMBL: ENSMUSP00000149157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000162655] [ENSMUST00000216281]
Predicted Effect probably benign
Transcript: ENSMUST00000093791
AA Change: M504I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534
AA Change: M504I

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:CEP63 76 338 8.1e-112 PFAM
coiled coil region 401 469 N/A INTRINSIC
coiled coil region 492 591 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
coiled coil region 730 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160512
Predicted Effect probably benign
Transcript: ENSMUST00000162655
AA Change: M446I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534
AA Change: M446I

DomainStartEndE-ValueType
coiled coil region 72 220 N/A INTRINSIC
coiled coil region 243 283 N/A INTRINSIC
coiled coil region 343 411 N/A INTRINSIC
coiled coil region 434 484 N/A INTRINSIC
coiled coil region 510 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162960
Predicted Effect probably benign
Transcript: ENSMUST00000216281
AA Change: M504I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Cep63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Cep63 APN 9 102590458 missense possibly damaging 0.88
IGL02378:Cep63 APN 9 102596115 splice site probably benign
IGL02707:Cep63 APN 9 102586981 missense probably damaging 1.00
IGL03273:Cep63 APN 9 102602467 missense probably benign 0.13
R0355:Cep63 UTSW 9 102623560 missense probably benign
R0847:Cep63 UTSW 9 102588758 missense probably benign 0.12
R1276:Cep63 UTSW 9 102588900 missense possibly damaging 0.77
R1398:Cep63 UTSW 9 102603086 splice site probably benign
R1654:Cep63 UTSW 9 102586913 missense possibly damaging 0.87
R1730:Cep63 UTSW 9 102618867 missense possibly damaging 0.93
R1982:Cep63 UTSW 9 102602880 missense probably damaging 0.99
R2359:Cep63 UTSW 9 102594564 missense possibly damaging 0.95
R2890:Cep63 UTSW 9 102618827 missense probably damaging 0.99
R3082:Cep63 UTSW 9 102602497 missense probably benign 0.00
R4725:Cep63 UTSW 9 102590556 intron probably benign
R4761:Cep63 UTSW 9 102587041 intron probably benign
R5200:Cep63 UTSW 9 102598188 missense probably benign 0.22
R5538:Cep63 UTSW 9 102588793 nonsense probably null
R6887:Cep63 UTSW 9 102625927 intron probably benign
R7854:Cep63 UTSW 9 102602998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCACGTACCACTAAG -3'
(R):5'- GTGCCTCTCTATAGTTGAAGGAACAG -3'

Sequencing Primer
(F):5'- ACTAAGGTAGTCATTTTCCTTGTCTG -3'
(R):5'- ACAGATTCTGCAGGCTGATC -3'
Posted On2018-05-21