Mutagenetix > Incidental Mutation

Incidental Mutation 'R6463:Cnot10'

517693

Institutional Source

Beutler Lab

Gene Symbol

Cnot10

Ensembl Gene

ENSMUSG00000056167

Gene Name

CCR4-NOT transcription complex, subunit 10

Synonyms

MMRRC Submission

045324-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114585878-114640184 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114625902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 221 (Y221C)

Ref Sequence

ENSEMBL: ENSMUSP00000148963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000213955] [ENSMUST00000215155] [ENSMUST00000216785] [ENSMUST00000217148]

AlphaFold

Q8BH15

Predicted Effect

probably damaging
Transcript: ENSMUST00000070117
AA Change: Y221C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167
AA Change: Y221C

Domain	Start	End	E-Value	Type
Blast:TPR	27	60	2e-10	BLAST
coiled coil region	73	107	N/A	INTRINSIC
TPR	110	143	4.32e1	SMART
low complexity region	182	198	N/A	INTRINSIC
TPR	293	326	3.37e-2	SMART
TPR	355	388	6.75e1	SMART
low complexity region	496	508	N/A	INTRINSIC
TPR	643	676	7.87e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213539

Predicted Effect

probably benign
Transcript: ENSMUST00000213955

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215155
AA Change: Y221C

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215701

Predicted Effect

probably damaging
Transcript: ENSMUST00000216785
AA Change: Y221C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217148
AA Change: Y221C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217296

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,938	H48L	probably damaging	Het
Aifm3	A	G	16: 17,500,789	I185V	probably benign	Het
Asb7	A	T	7: 66,660,236	D77E	probably damaging	Het
Cacna1i	T	C	15: 80,355,758	I336T	probably damaging	Het
Cadps2	A	T	6: 23,323,334	L1016*	probably null	Het
Ccdc129	A	G	6: 55,968,678	R795G	probably benign	Het
Cep63	C	A	9: 102,596,155	M504I	probably benign	Het
Chpf2	G	T	5: 24,589,526	L231F	probably damaging	Het
Col3a1	G	A	1: 45,342,205		probably benign	Het
Csl	T	C	10: 99,759,098	D35G	probably damaging	Het
Csmd3	T	C	15: 47,676,479	Y2286C	probably damaging	Het
Dbt	A	G	3: 116,539,760	E293G	possibly damaging	Het
Ddx31	T	A	2: 28,847,513		probably null	Het
Dnm1	T	C	2: 32,309,591		probably benign	Het
Elfn1	A	G	5: 139,972,285	Y348C	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha5	T	A	5: 84,106,710	I657F	probably damaging	Het
Fbp1	A	G	13: 62,865,010	F123S	possibly damaging	Het
Hkdc1	T	C	10: 62,393,702	N732S	probably damaging	Het
Itfg1	A	G	8: 85,736,151	S448P	probably benign	Het
Izumo2	A	G	7: 44,709,074	K84R	probably benign	Het
Kbtbd3	A	G	9: 4,316,921	Y24C	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Mdn1	T	C	4: 32,773,308	L5489P	probably damaging	Het
Mettl2	G	A	11: 105,132,581		probably null	Het
Mtr	T	C	13: 12,216,866	T651A	probably benign	Het
Naglu	A	G	11: 101,077,351		probably null	Het
Nkx6-1	G	T	5: 101,659,476	H347N	probably damaging	Het
Ntpcr	A	G	8: 125,736,104	E20G	probably benign	Het
Oas2	T	C	5: 120,734,981	R670G	probably null	Het
Olfr1208	T	C	2: 88,897,118	I160V	probably benign	Het
Olfr239	G	A	17: 33,199,638	V197I	probably benign	Het
Olfr698	C	G	7: 106,752,801	E196Q	probably benign	Het
Phldb2	A	C	16: 45,774,993	V902G	probably benign	Het
Rdh7	T	C	10: 127,885,781	R209G	probably benign	Het
Slc13a3	A	C	2: 165,445,653	L127R	probably damaging	Het
Slc6a20b	T	A	9: 123,604,949	I275F	possibly damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tmx4	T	C	2: 134,620,639	Y124C	probably damaging	Het
Trh	A	T	6: 92,242,843	M164K	possibly damaging	Het
Trhr	A	G	15: 44,197,585	N167S	probably benign	Het
Ttll7	G	A	3: 146,931,582	R490Q	possibly damaging	Het
Uck1	T	C	2: 32,258,655	N100S	probably benign	Het
Ucp3	A	T	7: 100,480,269	T104S	probably benign	Het
Vmn2r28	T	A	7: 5,486,436	H468L	probably benign	Het
Xaf1	G	A	11: 72,308,638	R67H	probably benign	Het
Ypel4	T	C	2: 84,736,743		probably benign	Het
Zfp687	A	G	3: 95,010,784	I559T	probably damaging	Het

Other mutations in Cnot10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Cnot10	APN	9	114631855	missense	probably benign	0.19
IGL02004:Cnot10	APN	9	114622930	missense	probably damaging	1.00
IGL03297:Cnot10	APN	9	114598716	missense	possibly damaging	0.87
BB003:Cnot10	UTSW	9	114617815	missense	probably damaging	1.00
BB013:Cnot10	UTSW	9	114617815	missense	probably damaging	1.00
R0348:Cnot10	UTSW	9	114598770	missense	probably benign	0.10
R0390:Cnot10	UTSW	9	114629150	nonsense	probably null
R1256:Cnot10	UTSW	9	114610681	missense	probably damaging	1.00
R1471:Cnot10	UTSW	9	114591551	missense	probably benign	0.00
R1607:Cnot10	UTSW	9	114629095	nonsense	probably null
R1721:Cnot10	UTSW	9	114614999	missense	probably benign
R1741:Cnot10	UTSW	9	114597824	missense	possibly damaging	0.87
R2116:Cnot10	UTSW	9	114626436	missense	probably damaging	1.00
R4073:Cnot10	UTSW	9	114622947	missense	possibly damaging	0.91
R4074:Cnot10	UTSW	9	114622947	missense	possibly damaging	0.91
R4075:Cnot10	UTSW	9	114622947	missense	possibly damaging	0.91
R4365:Cnot10	UTSW	9	114631881	nonsense	probably null
R4383:Cnot10	UTSW	9	114631881	nonsense	probably null
R4385:Cnot10	UTSW	9	114631881	nonsense	probably null
R4398:Cnot10	UTSW	9	114631881	nonsense	probably null
R4423:Cnot10	UTSW	9	114617920	missense	probably damaging	1.00
R4859:Cnot10	UTSW	9	114627464	missense	probably damaging	1.00
R4916:Cnot10	UTSW	9	114629134	missense	possibly damaging	0.72
R4927:Cnot10	UTSW	9	114617944	missense	probably damaging	1.00
R5153:Cnot10	UTSW	9	114613735	missense	probably damaging	1.00
R5677:Cnot10	UTSW	9	114629093	missense	probably damaging	1.00
R5702:Cnot10	UTSW	9	114629010	missense	probably damaging	0.98
R5790:Cnot10	UTSW	9	114625917	splice site	probably null
R6190:Cnot10	UTSW	9	114632723	missense	probably damaging	1.00
R6353:Cnot10	UTSW	9	114597546	missense	probably damaging	1.00
R6819:Cnot10	UTSW	9	114615055	missense	probably benign	0.10
R6849:Cnot10	UTSW	9	114631936	missense	probably benign	0.01
R6875:Cnot10	UTSW	9	114615107	missense	probably benign	0.00
R7071:Cnot10	UTSW	9	114617719	splice site	probably null
R7408:Cnot10	UTSW	9	114631826	missense	probably benign	0.33
R7412:Cnot10	UTSW	9	114625903	missense	probably damaging	1.00
R7645:Cnot10	UTSW	9	114613637	missense	probably benign
R7706:Cnot10	UTSW	9	114593438	missense	probably damaging	0.98
R7926:Cnot10	UTSW	9	114617815	missense	probably damaging	1.00
R8187:Cnot10	UTSW	9	114597488	nonsense	probably null
R8322:Cnot10	UTSW	9	114627469	missense	probably damaging	0.99
R8412:Cnot10	UTSW	9	114610670	missense	probably benign	0.11
R8904:Cnot10	UTSW	9	114601355	missense	probably benign	0.06
R9340:Cnot10	UTSW	9	114631829	missense	probably benign	0.01
R9691:Cnot10	UTSW	9	114591647	missense	probably damaging	1.00
X0062:Cnot10	UTSW	9	114615134	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTCGAGTGTACGTGTGCAG -3'
(R):5'- AGAACTTTGAAGTAGCCTGTAGTG -3'

Sequencing Primer
(F):5'- CCTGAACTTGGAGAGCGTTTCC -3'
(R):5'- GGCCTGCAATACATGAAGCCTTAG -3'

Posted On

2018-05-21