Incidental Mutation 'R6463:Fbp1'
ID517702
Institutional Source Beutler Lab
Gene Symbol Fbp1
Ensembl Gene ENSMUSG00000069805
Gene Namefructose bisphosphatase 1
SynonymsFbp-2, FBPase brain isoform, Fbp3, FBPase liver
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6463 (G1)
Quality Score181.009
Status Validated
Chromosome13
Chromosomal Location62864753-62888282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62865010 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 123 (F123S)
Ref Sequence ENSEMBL: ENSMUSP00000117146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092888] [ENSMUST00000150013]
Predicted Effect probably benign
Transcript: ENSMUST00000092888
AA Change: F328S

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090564
Gene: ENSMUSG00000069805
AA Change: F328S

DomainStartEndE-ValueType
Pfam:FBPase 12 334 7.3e-145 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150013
AA Change: F123S

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117146
Gene: ENSMUSG00000069805
AA Change: F123S

DomainStartEndE-ValueType
Pfam:FBPase 1 71 5.3e-35 PFAM
Pfam:FBPase 70 130 2.7e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fructose-1,6-bisphosphatase 1, a gluconeogenesis regulatory enzyme, catalyzes the hydrolysis of fructose 1,6-bisphosphate to fructose 6-phosphate and inorganic phosphate. Fructose-1,6-diphosphatase deficiency is associated with hypoglycemia and metabolic acidosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Fbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Fbp1 APN 13 62867379 missense probably damaging 0.99
IGL02224:Fbp1 APN 13 62888007 missense probably damaging 1.00
IGL02751:Fbp1 APN 13 62875143 splice site probably null
IGL02887:Fbp1 APN 13 62869080 missense probably benign
fruko UTSW 13 62875261 missense probably damaging 1.00
PIT4362001:Fbp1 UTSW 13 62867380 missense probably damaging 0.99
R0400:Fbp1 UTSW 13 62865068 missense probably benign 0.04
R0656:Fbp1 UTSW 13 62871285 missense probably benign 0.23
R1672:Fbp1 UTSW 13 62867431 missense probably damaging 0.98
R2420:Fbp1 UTSW 13 62871306 missense probably benign 0.00
R2422:Fbp1 UTSW 13 62871306 missense probably benign 0.00
R3859:Fbp1 UTSW 13 62865116 missense probably damaging 1.00
R4474:Fbp1 UTSW 13 62875261 missense probably damaging 1.00
R4990:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R4991:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R4992:Fbp1 UTSW 13 62865074 missense probably benign 0.09
R5656:Fbp1 UTSW 13 62875196 missense probably damaging 0.97
R7381:Fbp1 UTSW 13 62865053 missense probably benign 0.01
R7448:Fbp1 UTSW 13 62872750 missense possibly damaging 0.83
R8309:Fbp1 UTSW 13 62869017 missense probably benign
R8318:Fbp1 UTSW 13 62865011 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAGTGTGGCTGCCATTG -3'
(R):5'- ATCTTGTTTTCCAGCTGCGG -3'

Sequencing Primer
(F):5'- CCTGATACAGTGGCATTATAGCATG -3'
(R):5'- GCTGCTGTATGAGTGCAACC -3'
Posted On2018-05-21