Mutagenetix > Incidental Mutation

Incidental Mutation 'R6463:Cacna1i'

517706

Institutional Source

Beutler Lab

Gene Symbol

Cacna1i

Ensembl Gene

ENSMUSG00000022416

Gene Name

calcium channel, voltage-dependent, alpha 1I subunit

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6463 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80287238-80398279 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80355758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 336 (I336T)

Ref Sequence

ENSEMBL: ENSMUSP00000125229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]

AlphaFold

E9Q7P2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160424
AA Change: I336T

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: I336T

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	76	407	1.4e-79	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	597	830	7.4e-58	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1128	1401	7.8e-65	PFAM
Pfam:Ion_trans	1445	1700	9.4e-58	PFAM
Pfam:PKD_channel	1538	1694	1.4e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC
low complexity region	1837	1853	N/A	INTRINSIC
low complexity region	1922	1933	N/A	INTRINSIC
low complexity region	1990	2005	N/A	INTRINSIC
low complexity region	2041	2058	N/A	INTRINSIC
low complexity region	2087	2097	N/A	INTRINSIC
low complexity region	2103	2126	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162155
AA Change: I336T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: I336T

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	115	395	1.9e-66	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	632	819	2.4e-45	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1165	1389	6.2e-55	PFAM
coiled coil region	1394	1426	N/A	INTRINSIC
Pfam:Ion_trans	1480	1688	1.9e-47	PFAM
Pfam:PKD_channel	1538	1694	4.8e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC

Meta Mutation Damage Score

0.5788

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,450,938	H48L	probably damaging	Het
Aifm3	A	G	16: 17,500,789	I185V	probably benign	Het
Asb7	A	T	7: 66,660,236	D77E	probably damaging	Het
Cadps2	A	T	6: 23,323,334	L1016*	probably null	Het
Ccdc129	A	G	6: 55,968,678	R795G	probably benign	Het
Cep63	C	A	9: 102,596,155	M504I	probably benign	Het
Chpf2	G	T	5: 24,589,526	L231F	probably damaging	Het
Cnot10	T	C	9: 114,625,902	Y221C	probably damaging	Het
Col3a1	G	A	1: 45,342,205		probably benign	Het
Csl	T	C	10: 99,759,098	D35G	probably damaging	Het
Csmd3	T	C	15: 47,676,479	Y2286C	probably damaging	Het
Dbt	A	G	3: 116,539,760	E293G	possibly damaging	Het
Ddx31	T	A	2: 28,847,513		probably null	Het
Dnm1	T	C	2: 32,309,591		probably benign	Het
Elfn1	A	G	5: 139,972,285	Y348C	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epha5	T	A	5: 84,106,710	I657F	probably damaging	Het
Fbp1	A	G	13: 62,865,010	F123S	possibly damaging	Het
Hkdc1	T	C	10: 62,393,702	N732S	probably damaging	Het
Itfg1	A	G	8: 85,736,151	S448P	probably benign	Het
Izumo2	A	G	7: 44,709,074	K84R	probably benign	Het
Kbtbd3	A	G	9: 4,316,921	Y24C	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Mdn1	T	C	4: 32,773,308	L5489P	probably damaging	Het
Mettl2	G	A	11: 105,132,581		probably null	Het
Mtr	T	C	13: 12,216,866	T651A	probably benign	Het
Naglu	A	G	11: 101,077,351		probably null	Het
Nkx6-1	G	T	5: 101,659,476	H347N	probably damaging	Het
Ntpcr	A	G	8: 125,736,104	E20G	probably benign	Het
Oas2	T	C	5: 120,734,981	R670G	probably null	Het
Olfr1208	T	C	2: 88,897,118	I160V	probably benign	Het
Olfr239	G	A	17: 33,199,638	V197I	probably benign	Het
Olfr698	C	G	7: 106,752,801	E196Q	probably benign	Het
Phldb2	A	C	16: 45,774,993	V902G	probably benign	Het
Rdh7	T	C	10: 127,885,781	R209G	probably benign	Het
Slc13a3	A	C	2: 165,445,653	L127R	probably damaging	Het
Slc6a20b	T	A	9: 123,604,949	I275F	possibly damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tmx4	T	C	2: 134,620,639	Y124C	probably damaging	Het
Trh	A	T	6: 92,242,843	M164K	possibly damaging	Het
Trhr	A	G	15: 44,197,585	N167S	probably benign	Het
Ttll7	G	A	3: 146,931,582	R490Q	possibly damaging	Het
Uck1	T	C	2: 32,258,655	N100S	probably benign	Het
Ucp3	A	T	7: 100,480,269	T104S	probably benign	Het
Vmn2r28	T	A	7: 5,486,436	H468L	probably benign	Het
Xaf1	G	A	11: 72,308,638	R67H	probably benign	Het
Ypel4	T	C	2: 84,736,743		probably benign	Het
Zfp687	A	G	3: 95,010,784	I559T	probably damaging	Het

Other mutations in Cacna1i

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Cacna1i	APN	15	80382019	missense	probably damaging	1.00
IGL00976:Cacna1i	APN	15	80355645	missense	probably benign
IGL01338:Cacna1i	APN	15	80348380	missense	probably damaging	0.99
IGL01589:Cacna1i	APN	15	80387759	splice site	probably benign
IGL01669:Cacna1i	APN	15	80391757	missense	probably benign
IGL01807:Cacna1i	APN	15	80374147	missense	probably damaging	1.00
IGL01911:Cacna1i	APN	15	80391732	missense	probably benign	0.09
IGL01973:Cacna1i	APN	15	80382033	missense	probably damaging	1.00
IGL02205:Cacna1i	APN	15	80372951	missense	probably benign	0.06
IGL02519:Cacna1i	APN	15	80361874	nonsense	probably null
IGL02648:Cacna1i	APN	15	80298638	missense	probably damaging	0.96
IGL03033:Cacna1i	APN	15	80362239	missense	probably damaging	0.98
IGL03214:Cacna1i	APN	15	80355716	missense	probably benign	0.30
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0295:Cacna1i	UTSW	15	80356211	missense	probably damaging	1.00
R0345:Cacna1i	UTSW	15	80372462	missense	probably damaging	0.98
R0415:Cacna1i	UTSW	15	80368830	splice site	probably benign
R0637:Cacna1i	UTSW	15	80372654	missense	probably damaging	0.99
R0638:Cacna1i	UTSW	15	80381080	missense	possibly damaging	0.94
R0840:Cacna1i	UTSW	15	80358949	missense	possibly damaging	0.85
R1463:Cacna1i	UTSW	15	80379054	missense	possibly damaging	0.96
R1528:Cacna1i	UTSW	15	80391774	splice site	probably null
R1563:Cacna1i	UTSW	15	80321188	missense	probably damaging	0.97
R1563:Cacna1i	UTSW	15	80389855	splice site	probably benign
R1573:Cacna1i	UTSW	15	80393668	splice site	probably null
R1654:Cacna1i	UTSW	15	80389210	missense	probably damaging	1.00
R1754:Cacna1i	UTSW	15	80371529	missense	probably damaging	0.99
R1794:Cacna1i	UTSW	15	80389122	missense	probably damaging	1.00
R1824:Cacna1i	UTSW	15	80376789	missense	possibly damaging	0.64
R1863:Cacna1i	UTSW	15	80358931	missense	probably damaging	1.00
R1885:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1886:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1899:Cacna1i	UTSW	15	80391642	missense	possibly damaging	0.91
R1907:Cacna1i	UTSW	15	80375264	missense	probably damaging	1.00
R1943:Cacna1i	UTSW	15	80395044	missense	probably benign
R2162:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R2888:Cacna1i	UTSW	15	80374767	missense	probably damaging	1.00
R3701:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3702:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3832:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R4852:Cacna1i	UTSW	15	80388479	missense	probably damaging	0.99
R4857:Cacna1i	UTSW	15	80369662	missense	probably damaging	1.00
R4950:Cacna1i	UTSW	15	80368671	missense	probably damaging	1.00
R4980:Cacna1i	UTSW	15	80348449	missense	probably damaging	0.97
R5217:Cacna1i	UTSW	15	80390840	missense	possibly damaging	0.94
R5437:Cacna1i	UTSW	15	80371529	missense	probably damaging	1.00
R5519:Cacna1i	UTSW	15	80371499	missense	probably damaging	1.00
R5642:Cacna1i	UTSW	15	80395078	missense	possibly damaging	0.47
R6217:Cacna1i	UTSW	15	80389132	missense	probably damaging	1.00
R6225:Cacna1i	UTSW	15	80321226	missense	probably damaging	1.00
R6251:Cacna1i	UTSW	15	80336682	missense	probably damaging	1.00
R6490:Cacna1i	UTSW	15	80378247	missense	probably damaging	1.00
R6613:Cacna1i	UTSW	15	80321259	missense	probably damaging	1.00
R6884:Cacna1i	UTSW	15	80374809	missense	probably damaging	1.00
R6904:Cacna1i	UTSW	15	80374801	missense	probably damaging	1.00
R7017:Cacna1i	UTSW	15	80380470	missense	probably damaging	1.00
R7155:Cacna1i	UTSW	15	80395238	missense	probably benign	0.04
R7274:Cacna1i	UTSW	15	80376822	missense	possibly damaging	0.95
R7323:Cacna1i	UTSW	15	80391653	missense	possibly damaging	0.86
R7335:Cacna1i	UTSW	15	80375575	missense	probably damaging	1.00
R7571:Cacna1i	UTSW	15	80375336	missense	probably damaging	1.00
R7768:Cacna1i	UTSW	15	80381188	missense	probably damaging	1.00
R7820:Cacna1i	UTSW	15	80372372	missense	probably benign	0.00
R7987:Cacna1i	UTSW	15	80320352	splice site	probably null
R8150:Cacna1i	UTSW	15	80375339	missense	probably damaging	1.00
R8206:Cacna1i	UTSW	15	80389815	splice site	probably null
R8270:Cacna1i	UTSW	15	80373634	missense	probably damaging	0.99
R8382:Cacna1i	UTSW	15	80376816	missense	probably damaging	0.99
R8501:Cacna1i	UTSW	15	80382046	critical splice donor site	probably null
R8518:Cacna1i	UTSW	15	80358894	nonsense	probably null
R8552:Cacna1i	UTSW	15	80320397	missense	possibly damaging	0.69
R8679:Cacna1i	UTSW	15	80375810	intron	probably benign
R8696:Cacna1i	UTSW	15	80381974	missense	probably damaging	0.98
R8887:Cacna1i	UTSW	15	80374693	missense	possibly damaging	0.91
R9274:Cacna1i	UTSW	15	80370153	missense	probably damaging	1.00
R9379:Cacna1i	UTSW	15	80375294	missense	probably damaging	1.00
R9508:Cacna1i	UTSW	15	80395171	missense	probably benign	0.06
R9518:Cacna1i	UTSW	15	80387777	missense	probably damaging	1.00
X0022:Cacna1i	UTSW	15	80361962	missense	probably damaging	0.99
X0024:Cacna1i	UTSW	15	80362139	missense	probably benign	0.03
X0058:Cacna1i	UTSW	15	80379102	missense	probably damaging	1.00
Z1177:Cacna1i	UTSW	15	80381179	missense	possibly damaging	0.64
Z1177:Cacna1i	UTSW	15	80389383	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TTATGGGCTGTCACGAGATCC -3'
(R):5'- AGAGATACCGATGCCAGTGACC -3'

Sequencing Primer
(F):5'- GCTGTCACGAGATCCCTCCAC -3'
(R):5'- CACTCTCAGGAGGTAGGTGAC -3'

Posted On

2018-05-21