Incidental Mutation 'R6463:Aifm3'
ID 517707
Institutional Source Beutler Lab
Gene Symbol Aifm3
Ensembl Gene ENSMUSG00000022763
Gene Name apoptosis-inducing factor, mitochondrion-associated 3
Synonyms 2810401C16Rik
MMRRC Submission 045324-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R6463 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17307475-17325349 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17318653 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 185 (I185V)
Ref Sequence ENSEMBL: ENSMUSP00000111349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023448] [ENSMUST00000115685]
AlphaFold Q3TY86
Predicted Effect probably benign
Transcript: ENSMUST00000023448
AA Change: I185V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023448
Gene: ENSMUSG00000022763
AA Change: I185V

DomainStartEndE-ValueType
Pfam:Rieske 68 161 3.6e-18 PFAM
Pfam:Rieske_2 70 166 7.7e-11 PFAM
Pfam:Pyr_redox_2 196 473 1.1e-34 PFAM
Pfam:Pyr_redox 334 416 7e-17 PFAM
Pfam:Reductase_C 512 591 9.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115685
AA Change: I185V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111349
Gene: ENSMUSG00000022763
AA Change: I185V

DomainStartEndE-ValueType
Pfam:Rieske 68 161 6.5e-23 PFAM
Pfam:Rieske_2 70 166 1.4e-10 PFAM
Pfam:Pyr_redox_2 195 493 1.6e-65 PFAM
Pfam:Pyr_redox 334 416 7.3e-18 PFAM
Pfam:Reductase_C 512 586 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232421
Meta Mutation Damage Score 0.0685 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 (GRCm39) H48L probably damaging Het
Asb7 A T 7: 66,309,984 (GRCm39) D77E probably damaging Het
Cacna1i T C 15: 80,239,959 (GRCm39) I336T probably damaging Het
Cadps2 A T 6: 23,323,333 (GRCm39) L1016* probably null Het
Cep63 C A 9: 102,473,354 (GRCm39) M504I probably benign Het
Chpf2 G T 5: 24,794,524 (GRCm39) L231F probably damaging Het
Cnot10 T C 9: 114,454,970 (GRCm39) Y221C probably damaging Het
Col3a1 G A 1: 45,381,365 (GRCm39) probably benign Het
Csl T C 10: 99,594,960 (GRCm39) D35G probably damaging Het
Csmd3 T C 15: 47,539,875 (GRCm39) Y2286C probably damaging Het
Dbt A G 3: 116,333,409 (GRCm39) E293G possibly damaging Het
Ddx31 T A 2: 28,737,525 (GRCm39) probably null Het
Dnm1 T C 2: 32,199,603 (GRCm39) probably benign Het
Elfn1 A G 5: 139,958,040 (GRCm39) Y348C probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Epha5 T A 5: 84,254,569 (GRCm39) I657F probably damaging Het
Fbp1 A G 13: 63,012,824 (GRCm39) F123S possibly damaging Het
Hkdc1 T C 10: 62,229,481 (GRCm39) N732S probably damaging Het
Itfg1 A G 8: 86,462,780 (GRCm39) S448P probably benign Het
Itprid1 A G 6: 55,945,663 (GRCm39) R795G probably benign Het
Izumo2 A G 7: 44,358,498 (GRCm39) K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 (GRCm39) Y24C probably benign Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Mdn1 T C 4: 32,773,308 (GRCm39) L5489P probably damaging Het
Mettl2 G A 11: 105,023,407 (GRCm39) probably null Het
Mtr T C 13: 12,231,752 (GRCm39) T651A probably benign Het
Naglu A G 11: 100,968,177 (GRCm39) probably null Het
Nkx6-1 G T 5: 101,807,342 (GRCm39) H347N probably damaging Het
Ntpcr A G 8: 126,462,843 (GRCm39) E20G probably benign Het
Oas2 T C 5: 120,873,046 (GRCm39) R670G probably null Het
Or10h1 G A 17: 33,418,612 (GRCm39) V197I probably benign Het
Or2ag16 C G 7: 106,352,008 (GRCm39) E196Q probably benign Het
Or4p8 T C 2: 88,727,462 (GRCm39) I160V probably benign Het
Phldb2 A C 16: 45,595,356 (GRCm39) V902G probably benign Het
Rdh7 T C 10: 127,721,650 (GRCm39) R209G probably benign Het
Slc13a3 A C 2: 165,287,573 (GRCm39) L127R probably damaging Het
Slc6a20b T A 9: 123,434,014 (GRCm39) I275F possibly damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Tmx4 T C 2: 134,462,559 (GRCm39) Y124C probably damaging Het
Trh A T 6: 92,219,824 (GRCm39) M164K possibly damaging Het
Trhr A G 15: 44,060,981 (GRCm39) N167S probably benign Het
Ttll7 G A 3: 146,637,337 (GRCm39) R490Q possibly damaging Het
Uck1 T C 2: 32,148,667 (GRCm39) N100S probably benign Het
Ucp3 A T 7: 100,129,476 (GRCm39) T104S probably benign Het
Vmn2r28 T A 7: 5,489,435 (GRCm39) H468L probably benign Het
Xaf1 G A 11: 72,199,464 (GRCm39) R67H probably benign Het
Ypel4 T C 2: 84,567,087 (GRCm39) probably benign Het
Zfp687 A G 3: 94,918,095 (GRCm39) I559T probably damaging Het
Other mutations in Aifm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Aifm3 APN 16 17,318,228 (GRCm39) missense probably damaging 1.00
IGL01663:Aifm3 APN 16 17,320,650 (GRCm39) critical splice donor site probably null
IGL01669:Aifm3 APN 16 17,321,405 (GRCm39) missense probably benign 0.06
IGL01768:Aifm3 APN 16 17,324,141 (GRCm39) missense possibly damaging 0.92
IGL02562:Aifm3 APN 16 17,324,126 (GRCm39) missense probably benign 0.41
IGL02617:Aifm3 APN 16 17,318,397 (GRCm39) missense probably null 0.11
IGL03256:Aifm3 APN 16 17,324,174 (GRCm39) missense probably benign 0.07
P0026:Aifm3 UTSW 16 17,324,981 (GRCm39) unclassified probably benign
R0638:Aifm3 UTSW 16 17,321,535 (GRCm39) missense possibly damaging 0.78
R4928:Aifm3 UTSW 16 17,318,296 (GRCm39) intron probably benign
R5141:Aifm3 UTSW 16 17,317,586 (GRCm39) missense probably damaging 1.00
R5997:Aifm3 UTSW 16 17,319,994 (GRCm39) missense probably benign 0.00
R8112:Aifm3 UTSW 16 17,320,804 (GRCm39) missense probably damaging 0.96
R8962:Aifm3 UTSW 16 17,324,200 (GRCm39) critical splice donor site probably null
R9546:Aifm3 UTSW 16 17,317,604 (GRCm39) missense probably benign 0.01
R9547:Aifm3 UTSW 16 17,317,604 (GRCm39) missense probably benign 0.01
Z1177:Aifm3 UTSW 16 17,321,584 (GRCm39) missense probably benign 0.01
Z1177:Aifm3 UTSW 16 17,318,798 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCTTGGCTGGAGAAGAGCATG -3'
(R):5'- GATCCAGTGTGCAAAGGACAATC -3'

Sequencing Primer
(F):5'- CATGAGGCAAAGTCCTGTGGTG -3'
(R):5'- GACAATCCGGTCTGAGAAGCC -3'
Posted On 2018-05-21