Incidental Mutation 'R6463:Enpp5'
ID517710
Institutional Source Beutler Lab
Gene Symbol Enpp5
Ensembl Gene ENSMUSG00000023960
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 5
SynonymsD17Abb1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6463 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location44078813-44086567 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44085264 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 356 (G356S)
Ref Sequence ENSEMBL: ENSMUSP00000122767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]
Predicted Effect probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 7.1e-91 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126032
Predicted Effect probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Phosphodiest 30 342 2.1e-86 PFAM
transmembrane domain 430 452 N/A INTRINSIC
Meta Mutation Damage Score 0.9168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,450,938 H48L probably damaging Het
Aifm3 A G 16: 17,500,789 I185V probably benign Het
Asb7 A T 7: 66,660,236 D77E probably damaging Het
Cacna1i T C 15: 80,355,758 I336T probably damaging Het
Cadps2 A T 6: 23,323,334 L1016* probably null Het
Ccdc129 A G 6: 55,968,678 R795G probably benign Het
Cep63 C A 9: 102,596,155 M504I probably benign Het
Chpf2 G T 5: 24,589,526 L231F probably damaging Het
Cnot10 T C 9: 114,625,902 Y221C probably damaging Het
Col3a1 G A 1: 45,342,205 probably benign Het
Csl T C 10: 99,759,098 D35G probably damaging Het
Csmd3 T C 15: 47,676,479 Y2286C probably damaging Het
Dbt A G 3: 116,539,760 E293G possibly damaging Het
Ddx31 T A 2: 28,847,513 probably null Het
Dnm1 T C 2: 32,309,591 probably benign Het
Elfn1 A G 5: 139,972,285 Y348C probably damaging Het
Epha5 T A 5: 84,106,710 I657F probably damaging Het
Fbp1 A G 13: 62,865,010 F123S possibly damaging Het
Hkdc1 T C 10: 62,393,702 N732S probably damaging Het
Itfg1 A G 8: 85,736,151 S448P probably benign Het
Izumo2 A G 7: 44,709,074 K84R probably benign Het
Kbtbd3 A G 9: 4,316,921 Y24C probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Mdn1 T C 4: 32,773,308 L5489P probably damaging Het
Mettl2 G A 11: 105,132,581 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Naglu A G 11: 101,077,351 probably null Het
Nkx6-1 G T 5: 101,659,476 H347N probably damaging Het
Ntpcr A G 8: 125,736,104 E20G probably benign Het
Oas2 T C 5: 120,734,981 R670G probably null Het
Olfr1208 T C 2: 88,897,118 I160V probably benign Het
Olfr239 G A 17: 33,199,638 V197I probably benign Het
Olfr698 C G 7: 106,752,801 E196Q probably benign Het
Phldb2 A C 16: 45,774,993 V902G probably benign Het
Rdh7 T C 10: 127,885,781 R209G probably benign Het
Slc13a3 A C 2: 165,445,653 L127R probably damaging Het
Slc6a20b T A 9: 123,604,949 I275F possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tmx4 T C 2: 134,620,639 Y124C probably damaging Het
Trh A T 6: 92,242,843 M164K possibly damaging Het
Trhr A G 15: 44,197,585 N167S probably benign Het
Ttll7 G A 3: 146,931,582 R490Q possibly damaging Het
Uck1 T C 2: 32,258,655 N100S probably benign Het
Ucp3 A T 7: 100,480,269 T104S probably benign Het
Vmn2r28 T A 7: 5,486,436 H468L probably benign Het
Xaf1 G A 11: 72,308,638 R67H probably benign Het
Ypel4 T C 2: 84,736,743 probably benign Het
Zfp687 A G 3: 95,010,784 I559T probably damaging Het
Other mutations in Enpp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Enpp5 APN 17 44085197 splice site probably benign
IGL01593:Enpp5 APN 17 44080721 missense probably benign
IGL01654:Enpp5 APN 17 44081175 missense possibly damaging 0.82
IGL02120:Enpp5 APN 17 44080845 missense probably benign 0.04
IGL02142:Enpp5 APN 17 44085577 missense probably benign 0.01
IGL02531:Enpp5 APN 17 44080952 missense probably damaging 1.00
IGL02630:Enpp5 APN 17 44082875 missense probably damaging 1.00
Cacao UTSW 17 44085576 missense probably benign 0.00
canola UTSW 17 44085264 missense probably damaging 1.00
R1101:Enpp5 UTSW 17 44081367 missense possibly damaging 0.77
R2074:Enpp5 UTSW 17 44085373 missense probably benign 0.25
R2679:Enpp5 UTSW 17 44085388 missense probably damaging 1.00
R4739:Enpp5 UTSW 17 44081136 missense probably damaging 1.00
R4817:Enpp5 UTSW 17 44080980 makesense probably null
R5152:Enpp5 UTSW 17 44081133 missense probably damaging 1.00
R6021:Enpp5 UTSW 17 44085319 missense probably benign 0.22
R6160:Enpp5 UTSW 17 44081368 missense possibly damaging 0.77
R6330:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6385:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6387:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6452:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6454:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6461:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6462:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6469:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6470:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6471:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6473:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6505:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6563:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6564:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6760:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6812:Enpp5 UTSW 17 44085576 missense probably benign 0.00
R6821:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6824:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6963:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R6965:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7169:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7171:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7375:Enpp5 UTSW 17 44080977 missense probably benign 0.02
R7393:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7394:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7411:Enpp5 UTSW 17 44081475 missense probably damaging 1.00
R7412:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7446:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7447:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7560:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7561:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7589:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7590:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
R7591:Enpp5 UTSW 17 44085264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- ACTCTGTGTGTAAGGAATTGGC -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTTGGGAGTTGCTGAACTGAGAAG -3'
Posted On2018-05-21