Incidental Mutation 'R6464:Vmn2r1'
ID517720
Institutional Source Beutler Lab
Gene Symbol Vmn2r1
Ensembl Gene ENSMUSG00000027824
Gene Namevomeronasal 2, receptor 1
SynonymsEG56544, V2r83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R6464 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64081642-64105458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64101345 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 482 (D482N)
Ref Sequence ENSEMBL: ENSMUSP00000029406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029406]
Predicted Effect probably benign
Transcript: ENSMUST00000029406
AA Change: D482N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029406
Gene: ENSMUSG00000027824
AA Change: D482N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 86 504 6e-92 PFAM
Pfam:NCD3G 546 599 2.4e-17 PFAM
Pfam:7tm_3 632 866 4.1e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,447,490 S769T probably damaging Het
Apoe G A 7: 19,697,536 T52M probably damaging Het
Arhgef10l A C 4: 140,586,815 M230R probably benign Het
Cdkl4 A T 17: 80,525,352 I321N probably benign Het
Ceacam5 T C 7: 17,747,466 probably null Het
Cfap70 T C 14: 20,401,039 probably null Het
Clasp2 A G 9: 113,773,717 Y195C probably damaging Het
Clip2 T C 5: 134,491,925 I999V probably benign Het
Cntnap5a A G 1: 116,184,408 D476G probably benign Het
Col6a6 C T 9: 105,788,953 M1I probably null Het
Cyp27a1 T C 1: 74,735,888 V292A possibly damaging Het
Cyp2c29 A G 19: 39,329,225 Y385C probably damaging Het
Dsg3 A C 18: 20,533,526 R597S probably benign Het
Fam131c T C 4: 141,382,342 I95T probably damaging Het
Fam13b A T 18: 34,473,631 C302* probably null Het
Fkbp15 T C 4: 62,308,078 K745E possibly damaging Het
Flg T A 3: 93,281,381 probably benign Het
Gm11559 T C 11: 99,864,716 C64R unknown Het
Gm14025 T C 2: 129,039,545 T154A possibly damaging Het
Gm35339 A G 15: 76,362,777 T1413A probably benign Het
Helt T C 8: 46,292,534 D104G probably damaging Het
Helz2 T C 2: 181,235,069 T1211A probably benign Het
Ifna9 T C 4: 88,592,250 R46G possibly damaging Het
Kif20b G A 19: 34,934,441 V235I probably benign Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lipf A T 19: 33,973,544 Y305F probably benign Het
Lpar1 A G 4: 58,486,875 L132P possibly damaging Het
Magi1 A T 6: 93,699,789 V834E probably damaging Het
Meltf T C 16: 31,890,776 Y432H probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo1f T C 17: 33,576,647 L59P probably damaging Het
Naa25 G A 5: 121,417,961 D271N probably damaging Het
Olfr1038-ps A T 2: 86,122,408 I162F possibly damaging Het
Olfr1117-ps1 A T 2: 87,309,607 I273F probably damaging Het
Otoa A G 7: 121,102,605 Q169R probably damaging Het
Pde4dip C T 3: 97,710,344 D1723N probably damaging Het
Ptdss2 T C 7: 141,152,211 V175A probably damaging Het
Rdh8 G T 9: 20,823,400 R121L probably damaging Het
Rpl23 T C 11: 97,778,285 probably null Het
Scn5a T C 9: 119,534,580 D498G probably damaging Het
Slc39a14 G C 14: 70,306,728 L470V probably damaging Het
Smok2a C T 17: 13,226,430 A298V probably damaging Het
Tesk2 A C 4: 116,802,849 D388A probably damaging Het
Tnik G A 3: 28,611,970 probably null Het
Ube3a T A 7: 59,276,183 Y236* probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r74 A T 7: 11,847,204 I144L possibly damaging Het
Vwf T C 6: 125,639,400 probably null Het
Zfp703 C G 8: 26,979,327 P340A probably damaging Het
Znfx1 T C 2: 167,046,922 S789G probably benign Het
Other mutations in Vmn2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn2r1 APN 3 64104968 nonsense probably null
IGL00335:Vmn2r1 APN 3 64105388 missense probably damaging 0.96
IGL01509:Vmn2r1 APN 3 64103045 missense probably benign 0.03
IGL01641:Vmn2r1 APN 3 64104503 missense probably benign 0.19
IGL01656:Vmn2r1 APN 3 64081853 missense probably damaging 0.96
IGL01927:Vmn2r1 APN 3 64081684 missense probably benign 0.01
IGL02093:Vmn2r1 APN 3 64104709 missense probably benign
IGL02146:Vmn2r1 APN 3 64104683 missense probably benign 0.39
IGL02186:Vmn2r1 APN 3 64081717 missense probably benign 0.01
IGL02320:Vmn2r1 APN 3 64081759 missense possibly damaging 0.61
IGL02423:Vmn2r1 APN 3 64090244 missense probably benign 0.00
IGL02709:Vmn2r1 APN 3 64104934 missense probably benign 0.24
R0034:Vmn2r1 UTSW 3 64090014 missense probably damaging 1.00
R0064:Vmn2r1 UTSW 3 64104788 missense possibly damaging 0.76
R0152:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0305:Vmn2r1 UTSW 3 64089666 missense probably damaging 1.00
R0314:Vmn2r1 UTSW 3 64086559 missense probably damaging 1.00
R0317:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0465:Vmn2r1 UTSW 3 64081759 missense possibly damaging 0.61
R1144:Vmn2r1 UTSW 3 64090120 missense probably damaging 1.00
R1163:Vmn2r1 UTSW 3 64086625 missense probably benign 0.03
R1448:Vmn2r1 UTSW 3 64101313 missense probably damaging 1.00
R1491:Vmn2r1 UTSW 3 64089613 missense probably damaging 1.00
R1543:Vmn2r1 UTSW 3 64089573 missense probably damaging 1.00
R1611:Vmn2r1 UTSW 3 64104537 nonsense probably null
R1676:Vmn2r1 UTSW 3 64090182 nonsense probably null
R1727:Vmn2r1 UTSW 3 64081742 missense probably benign
R1851:Vmn2r1 UTSW 3 64101505 missense probably benign 0.32
R3080:Vmn2r1 UTSW 3 64089784 missense probably damaging 1.00
R3790:Vmn2r1 UTSW 3 64086764 critical splice donor site probably null
R4111:Vmn2r1 UTSW 3 64089755 missense probably benign 0.23
R4689:Vmn2r1 UTSW 3 64104653 missense possibly damaging 0.94
R4747:Vmn2r1 UTSW 3 64081846 missense probably benign 0.00
R4970:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5033:Vmn2r1 UTSW 3 64105080 missense probably damaging 1.00
R5086:Vmn2r1 UTSW 3 64089997 missense probably benign 0.00
R5112:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5385:Vmn2r1 UTSW 3 64101398 missense possibly damaging 0.89
R5629:Vmn2r1 UTSW 3 64105117 missense possibly damaging 0.87
R5762:Vmn2r1 UTSW 3 64090053 missense probably benign 0.24
R5867:Vmn2r1 UTSW 3 64104569 missense probably benign
R5893:Vmn2r1 UTSW 3 64086553 missense probably damaging 1.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6290:Vmn2r1 UTSW 3 64105452 missense probably benign 0.02
R6443:Vmn2r1 UTSW 3 64104953 missense possibly damaging 0.78
R6826:Vmn2r1 UTSW 3 64105146 nonsense probably null
R6874:Vmn2r1 UTSW 3 64104955 missense probably damaging 1.00
R6882:Vmn2r1 UTSW 3 64090108 missense possibly damaging 0.64
R6983:Vmn2r1 UTSW 3 64081697 missense probably benign
R7010:Vmn2r1 UTSW 3 64104725 missense probably benign 0.19
R7144:Vmn2r1 UTSW 3 64089941 missense probably damaging 1.00
R7341:Vmn2r1 UTSW 3 64105456 makesense probably null
R7510:Vmn2r1 UTSW 3 64086501 missense probably damaging 1.00
R7557:Vmn2r1 UTSW 3 64090054 missense probably damaging 0.99
R7895:Vmn2r1 UTSW 3 64089709 missense possibly damaging 0.90
R8108:Vmn2r1 UTSW 3 64103050 missense probably damaging 0.98
R8209:Vmn2r1 UTSW 3 64089778 missense possibly damaging 0.64
R8365:Vmn2r1 UTSW 3 64086613 missense possibly damaging 0.80
X0065:Vmn2r1 UTSW 3 64090257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCAACCATGCTTGAAGTTTC -3'
(R):5'- ACCCTTGATGACTCAGTGTTCC -3'

Sequencing Primer
(F):5'- CACATGTGGATAGAGATTGTCATAG -3'
(R):5'- TGATGACTCAGTGTTCCAAAATATTG -3'
Posted On2018-05-21